Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9371Btlr/Mmmh
Stock Number:
069179-MU
Citation ID:
RRID:MMRRC_069179-MU
Other Names:
R9371 (G1)
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Agps
Name: alkylglycerone phosphate synthase
Synonyms: ADAPS, 9930035G10Rik, bs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228061
HGNC: HGNC:327
Homologene: 2716
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Zfp442
Name: zinc finger protein 442
Synonyms: OTTMUSG00000015730
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668923
Homologene: 136215
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp-E7I, HSP110, Hsp105, hsp110/105
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15505
Homologene: 21322
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Slc39a14
Name: solute carrier family 39 (zinc transporter), member 14
Synonyms: G630015O18Rik, Zip14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213053
Homologene: 15037
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Rnft2
Name: ring finger protein, transmembrane 2
Synonyms: B830028P19Rik, Tmem118
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269695
Homologene: 41892
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mrm3
Name: mitochondrial rRNA methyltransferase 3
Synonyms: HC90, 4833420N02Rik, Rnmtl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67390
Homologene: 10033
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Mug5
Name: murinoglobulin 5
Synonyms: Gm7298
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 640530
HGNC: HGNC:9750
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Zfp947
Name: zinc finger protein 947
Synonyms: Gm4769
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210853
Homologene: 133253
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: 1600012D06Rik, Abp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
Gmpr
Name: guanosine monophosphate reductase
Synonyms: 2310004P21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66355
HGNC: HGNC:4376
Homologene: 5009
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Inhca
Name: inhibitor of carbonic anhydrase
Synonyms: mICA, 1300017J02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71775
Homologene: 826
Cenpo
Name: centromere protein O
Synonyms: D12Ertd482e, 8430427C03Rik, 2810429O05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52504
Homologene: 49760
Gcnt4
Name: glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Synonyms: LOC238786, LOC218476, C2GNT3, Gm73
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218476
VEGA: 13
Homologene: 41144
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Necab2
Name: N-terminal EF-hand calcium binding protein 2
Synonyms: Necab2, Efcbp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 117148
Homologene: 62200
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Hnf1b
Name: HNF1 homeobox B
Synonyms: hepatocyte nuclear factor-1 beta, vHNF1, Tcf-2, HNF-1Beta, Hnf1beta, LFB3, Tcf2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21410
Homologene: 396
Ero1b
Name: endoplasmic reticulum oxidoreductase 1 beta
Synonyms: 1700065B09Rik, 1300013B24Rik, Ero1lb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67475
VEGA: 13
Homologene: 8740
Or8c17
Name: olfactory receptor family 8 subfamily C member 17
Synonyms: GA_x6K02T2PVTD-31962461-31963411, MOR170-1, Olfr895
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258875
Homologene: 74253
Taar8a
Name: trace amine-associated receptor 8A
Synonyms: LOC215859
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215859
Homologene: 77586
Kcnj15
Name: potassium inwardly-rectifying channel, subfamily J, member 15
Synonyms: IRKK, Kir4.2, 4930414N08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16516
HGNC: HGNC:6261
Homologene: 1690
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
1810009J06Rik
Name: RIKEN cDNA 1810009J06 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73626
Homologene: 117995
Slc22a17
Name: solute carrier family 22 (organic cation transporter), member 17
Synonyms: 1700094C23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 59049
VEGA: 14
Homologene: 10684
Prss27
Name: serine protease 27
Synonyms: marapsin, CAPH2, Mpn, Pancreasin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213171
Homologene: 23743
Scgb2b3
Name: secretoglobin, family 2B, member 3
Synonyms: Gm4362, Abpbg3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043326
Homologene: 83171
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: MOR218-7, GA_x6K02T2PSCP-2354126-2355093, Olfr127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258374
Homologene: 134080
Ffar2
Name: free fatty acid receptor 2
Synonyms: Gpr43
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233079
HGNC: HGNC:4501
Homologene: 133911
S100a7l2
Name: S100 calcium binding protein A7 like 2
Synonyms: LOC229550, 9130204L05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229550
Homologene: 135857
Tmie
Name: transmembrane inner ear
Synonyms: Mm.87012, 5131400L21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20776
Homologene: 17155
Spata31e1
Name: spermatogenesis associated 31 subfamily E member 1
Synonyms: Gm30302
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102632152
VEGA: 13
Homologene: 141176
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 43,960,209 bp (GRCm38)
  • T to C, chromosome 1 at 135,978,263 bp (GRCm38)
  • T to A, chromosome 1 at 162,968,712 bp (GRCm38)
  • G to T, chromosome 2 at 31,411,905 bp (GRCm38)
  • G to T, chromosome 2 at 44,998,900 bp (GRCm38)
  • T to A, chromosome 2 at 75,911,680 bp (GRCm38)
  • G to C, chromosome 2 at 76,946,478 bp (GRCm38)
  • A to T, chromosome 2 at 150,408,756 bp (GRCm38)
  • T to C, chromosome 3 at 79,174,993 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to C, chromosome 3 at 91,090,391 bp (GRCm38)
  • A to G, chromosome 3 at 144,926,084 bp (GRCm38)
  • A to G, chromosome 4 at 34,810,800 bp (GRCm38)
  • T to C, chromosome 4 at 155,860,602 bp (GRCm38)
  • A to G, chromosome 5 at 3,961,852 bp (GRCm38)
  • T to A, chromosome 5 at 109,086,586 bp (GRCm38)
  • A to G, chromosome 5 at 118,202,917 bp (GRCm38)
  • A to T, chromosome 5 at 149,619,930 bp (GRCm38)
  • T to C, chromosome 6 at 40,966,729 bp (GRCm38)
  • A to G, chromosome 6 at 48,906,168 bp (GRCm38)
  • T to A, chromosome 6 at 64,700,522 bp (GRCm38)
  • A to G, chromosome 6 at 67,896,368 bp (GRCm38)
  • A to G, chromosome 6 at 120,762,268 bp (GRCm38)
  • A to G, chromosome 6 at 121,767,582 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to T, chromosome 7 at 30,819,504 bp (GRCm38)
  • T to A, chromosome 7 at 31,360,217 bp (GRCm38)
  • C to T, chromosome 8 at 119,447,184 bp (GRCm38)
  • T to A, chromosome 9 at 38,268,630 bp (GRCm38)
  • A to T, chromosome 9 at 103,281,053 bp (GRCm38)
  • A to T, chromosome 9 at 110,867,583 bp (GRCm38)
  • A to G, chromosome 10 at 4,103,335 bp (GRCm38)
  • T to C, chromosome 10 at 24,076,855 bp (GRCm38)
  • G to A, chromosome 11 at 67,219,805 bp (GRCm38)
  • A to G, chromosome 11 at 76,247,460 bp (GRCm38)
  • T to C, chromosome 11 at 83,889,160 bp (GRCm38)
  • T to G, chromosome 11 at 106,691,121 bp (GRCm38)
  • T to G, chromosome 11 at 109,967,672 bp (GRCm38)
  • A to G, chromosome 11 at 119,671,326 bp (GRCm38)
  • C to T, chromosome 12 at 4,216,686 bp (GRCm38)
  • A to G, chromosome 12 at 31,298,864 bp (GRCm38)
  • T to C, chromosome 12 at 100,126,218 bp (GRCm38)
  • A to G, chromosome 12 at 104,704,732 bp (GRCm38)
  • T to G, chromosome 13 at 12,574,847 bp (GRCm38)
  • T to C, chromosome 13 at 45,545,995 bp (GRCm38)
  • G to C, chromosome 13 at 49,785,576 bp (GRCm38)
  • G to T, chromosome 13 at 96,947,126 bp (GRCm38)
  • T to A, chromosome 13 at 100,161,846 bp (GRCm38)
  • A to T, chromosome 14 at 54,909,682 bp (GRCm38)
  • G to A, chromosome 14 at 70,310,120 bp (GRCm38)
  • T to C, chromosome 15 at 91,723,204 bp (GRCm38)
  • A to G, chromosome 16 at 95,296,697 bp (GRCm38)
  • A to G, chromosome 17 at 12,705,759 bp (GRCm38)
  • C to T, chromosome 17 at 21,397,791 bp (GRCm38)
  • G to A, chromosome 17 at 22,145,403 bp (GRCm38)
  • T to C, chromosome 17 at 24,038,167 bp (GRCm38)
  • A to G, chromosome 17 at 37,904,071 bp (GRCm38)
  • C to A, chromosome 18 at 67,434,192 bp (GRCm38)
  • G to A, chromosome 19 at 40,326,880 bp (GRCm38)
  • A to G, chromosome 19 at 53,233,068 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9371 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069179-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.