Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9371Btlr/Mmmh
Stock Number:
069179-MU
Citation ID:
RRID:MMRRC_069179-MU
Other Names:
R9371 (G1)
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Dicer1
Name: dicer 1, ribonuclease type III
Synonyms: 1110006F08Rik, D12Ertd7e, Dicer1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 192119
VEGA: 12
Homologene: 13251
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 43,960,209 bp (GRCm38)
  • T to C, chromosome 1 at 135,978,263 bp (GRCm38)
  • T to A, chromosome 1 at 162,968,712 bp (GRCm38)
  • G to T, chromosome 2 at 31,411,905 bp (GRCm38)
  • G to T, chromosome 2 at 44,998,900 bp (GRCm38)
  • T to A, chromosome 2 at 75,911,680 bp (GRCm38)
  • G to C, chromosome 2 at 76,946,478 bp (GRCm38)
  • A to T, chromosome 2 at 150,408,756 bp (GRCm38)
  • T to C, chromosome 3 at 79,174,993 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to C, chromosome 3 at 91,090,391 bp (GRCm38)
  • A to G, chromosome 3 at 144,926,084 bp (GRCm38)
  • A to G, chromosome 4 at 34,810,800 bp (GRCm38)
  • T to C, chromosome 4 at 155,860,602 bp (GRCm38)
  • A to G, chromosome 5 at 3,961,852 bp (GRCm38)
  • T to A, chromosome 5 at 109,086,586 bp (GRCm38)
  • A to G, chromosome 5 at 118,202,917 bp (GRCm38)
  • A to T, chromosome 5 at 149,619,930 bp (GRCm38)
  • T to C, chromosome 6 at 40,966,729 bp (GRCm38)
  • A to G, chromosome 6 at 48,906,168 bp (GRCm38)
  • T to A, chromosome 6 at 64,700,522 bp (GRCm38)
  • A to G, chromosome 6 at 67,896,368 bp (GRCm38)
  • A to G, chromosome 6 at 120,762,268 bp (GRCm38)
  • A to G, chromosome 6 at 121,767,582 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to T, chromosome 7 at 30,819,504 bp (GRCm38)
  • T to A, chromosome 7 at 31,360,217 bp (GRCm38)
  • C to T, chromosome 8 at 119,447,184 bp (GRCm38)
  • T to A, chromosome 9 at 38,268,630 bp (GRCm38)
  • A to T, chromosome 9 at 103,281,053 bp (GRCm38)
  • A to T, chromosome 9 at 110,867,583 bp (GRCm38)
  • A to G, chromosome 10 at 4,103,335 bp (GRCm38)
  • T to C, chromosome 10 at 24,076,855 bp (GRCm38)
  • G to A, chromosome 11 at 67,219,805 bp (GRCm38)
  • A to G, chromosome 11 at 76,247,460 bp (GRCm38)
  • T to C, chromosome 11 at 83,889,160 bp (GRCm38)
  • T to G, chromosome 11 at 106,691,121 bp (GRCm38)
  • T to G, chromosome 11 at 109,967,672 bp (GRCm38)
  • A to G, chromosome 11 at 119,671,326 bp (GRCm38)
  • C to T, chromosome 12 at 4,216,686 bp (GRCm38)
  • A to G, chromosome 12 at 31,298,864 bp (GRCm38)
  • T to C, chromosome 12 at 100,126,218 bp (GRCm38)
  • A to G, chromosome 12 at 104,704,732 bp (GRCm38)
  • T to G, chromosome 13 at 12,574,847 bp (GRCm38)
  • T to C, chromosome 13 at 45,545,995 bp (GRCm38)
  • G to C, chromosome 13 at 49,785,576 bp (GRCm38)
  • G to T, chromosome 13 at 96,947,126 bp (GRCm38)
  • T to A, chromosome 13 at 100,161,846 bp (GRCm38)
  • A to T, chromosome 14 at 54,909,682 bp (GRCm38)
  • G to A, chromosome 14 at 70,310,120 bp (GRCm38)
  • T to C, chromosome 15 at 91,723,204 bp (GRCm38)
  • A to G, chromosome 16 at 95,296,697 bp (GRCm38)
  • A to G, chromosome 17 at 12,705,759 bp (GRCm38)
  • C to T, chromosome 17 at 21,397,791 bp (GRCm38)
  • G to A, chromosome 17 at 22,145,403 bp (GRCm38)
  • T to C, chromosome 17 at 24,038,167 bp (GRCm38)
  • A to G, chromosome 17 at 37,904,071 bp (GRCm38)
  • C to A, chromosome 18 at 67,434,192 bp (GRCm38)
  • G to A, chromosome 19 at 40,326,880 bp (GRCm38)
  • A to G, chromosome 19 at 53,233,068 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9371 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069179-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.