Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9372Btlr/Mmmh
Stock Number:
069180-MU
Citation ID:
RRID:MMRRC_069180-MU
Other Names:
R9372 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Gtf2a1
Name: general transcription factor II A, 1
Synonyms: TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik, Tfiia1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 83602
HGNC: HGNC:4646
Homologene: 56331
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Smyd3
Name: SET and MYND domain containing 3
Synonyms: Zmynd1, 2410008A19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69726
Homologene: 41491
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 36,702,480 bp (GRCm38)
  • T to C, chromosome 1 at 53,504,315 bp (GRCm38)
  • T to C, chromosome 1 at 59,330,983 bp (GRCm38)
  • C to T, chromosome 1 at 85,905,334 bp (GRCm38)
  • T to C, chromosome 1 at 179,043,905 bp (GRCm38)
  • T to G, chromosome 2 at 82,992,412 bp (GRCm38)
  • T to A, chromosome 2 at 120,664,939 bp (GRCm38)
  • T to A, chromosome 2 at 120,773,285 bp (GRCm38)
  • T to A, chromosome 2 at 132,865,882 bp (GRCm38)
  • A to G, chromosome 2 at 157,469,888 bp (GRCm38)
  • G to T, chromosome 3 at 87,988,303 bp (GRCm38)
  • A to T, chromosome 3 at 142,829,257 bp (GRCm38)
  • T to C, chromosome 4 at 11,303,343 bp (GRCm38)
  • T to A, chromosome 4 at 59,003,394 bp (GRCm38)
  • A to T, chromosome 5 at 9,140,399 bp (GRCm38)
  • A to G, chromosome 5 at 24,400,116 bp (GRCm38)
  • A to T, chromosome 5 at 34,163,658 bp (GRCm38)
  • A to G, chromosome 5 at 74,546,802 bp (GRCm38)
  • G to A, chromosome 5 at 109,294,087 bp (GRCm38)
  • A to T, chromosome 5 at 111,183,207 bp (GRCm38)
  • G to A, chromosome 5 at 127,563,081 bp (GRCm38)
  • A to G, chromosome 5 at 130,059,823 bp (GRCm38)
  • A to G, chromosome 5 at 137,633,691 bp (GRCm38)
  • A to T, chromosome 5 at 138,251,183 bp (GRCm38)
  • G to A, chromosome 6 at 23,045,707 bp (GRCm38)
  • T to C, chromosome 6 at 23,078,857 bp (GRCm38)
  • A to T, chromosome 6 at 28,256,434 bp (GRCm38)
  • A to T, chromosome 6 at 58,215,761 bp (GRCm38)
  • A to G, chromosome 6 at 121,771,787 bp (GRCm38)
  • A to C, chromosome 6 at 122,279,740 bp (GRCm38)
  • A to G, chromosome 6 at 125,226,709 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • T to C, chromosome 6 at 146,996,809 bp (GRCm38)
  • T to C, chromosome 7 at 17,747,342 bp (GRCm38)
  • C to T, chromosome 7 at 18,069,304 bp (GRCm38)
  • T to A, chromosome 7 at 19,162,938 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • C to A, chromosome 7 at 30,104,807 bp (GRCm38)
  • T to A, chromosome 7 at 41,650,284 bp (GRCm38)
  • C to T, chromosome 7 at 126,896,845 bp (GRCm38)
  • G to A, chromosome 8 at 47,053,592 bp (GRCm38)
  • C to A, chromosome 8 at 66,468,493 bp (GRCm38)
  • C to T, chromosome 8 at 68,819,315 bp (GRCm38)
  • A to G, chromosome 9 at 7,206,780 bp (GRCm38)
  • G to A, chromosome 9 at 37,652,649 bp (GRCm38)
  • A to C, chromosome 9 at 44,297,786 bp (GRCm38)
  • A to G, chromosome 9 at 98,903,425 bp (GRCm38)
  • G to A, chromosome 9 at 107,517,603 bp (GRCm38)
  • A to T, chromosome 10 at 36,832,702 bp (GRCm38)
  • A to G, chromosome 10 at 76,423,126 bp (GRCm38)
  • A to T, chromosome 10 at 115,385,318 bp (GRCm38)
  • T to A, chromosome 11 at 80,094,268 bp (GRCm38)
  • C to T, chromosome 11 at 100,379,565 bp (GRCm38)
  • C to T, chromosome 11 at 106,142,509 bp (GRCm38)
  • T to A, chromosome 12 at 35,101,049 bp (GRCm38)
  • T to C, chromosome 12 at 85,747,021 bp (GRCm38)
  • C to T, chromosome 12 at 91,567,818 bp (GRCm38)
  • T to A, chromosome 12 at 113,826,737 bp (GRCm38)
  • T to C, chromosome 12 at 114,829,274 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • T to C, chromosome 15 at 102,326,851 bp (GRCm38)
  • G to A, chromosome 16 at 36,722,359 bp (GRCm38)
  • A to G, chromosome 17 at 21,722,054 bp (GRCm38)
  • A to T, chromosome 18 at 20,088,432 bp (GRCm38)
  • G to T, chromosome 18 at 58,659,685 bp (GRCm38)
  • C to T, chromosome 19 at 13,749,705 bp (GRCm38)
  • T to C, chromosome 19 at 37,411,444 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9372 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069180-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.