Strain Name:
C57BL/6J-MtgxR9372Btlr/Mmmh
Stock Number:
069180-MU
Citation ID:
RRID:MMRRC_069180-MU
Other Names:
R9372 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: PTPzeta, DSD-1-PG, RPTPz, Ptpz, PTPbeta, Rptpbeta, phosphacan, Ptprz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Zfp7
Name: zinc finger protein 7
Synonyms: Zfp86-rs1, KRAB7, Zfp65, mszf73-2, Zfp-7, Krox-2, KRAB20, Zfp80
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Gtf2a1
Name: general transcription factor II A, 1
Synonyms: TfIIAa/b, 6330549H03Rik, Tfiia1, 19kDa, 37kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 83602
HGNC: HGNC:4646
Homologene: 56331
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: C130052G03Rik, LOC237877
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Kif11
Name: kinesin family member 11
Synonyms: Kifl1, Eg5, Knsl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Smyd3
Name: SET and MYND domain containing 3
Synonyms: 2410008A19Rik, Zmynd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69726
Homologene: 41491
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m239Asp, m275Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2810008P14Rik, 2900069C24Rik, LRN, LRRN4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Pkn2
Name: protein kinase N2
Synonyms: Stk7, Prkcl2, PRK2, 6030436C20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: 1300019H17Rik, Rje
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Abcb8
Name: ATP-binding cassette, sub-family B member 8
Synonyms: 4833412N02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74610
HGNC: HGNC:49
Homologene: 5203
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Bcan
Name: brevican
Synonyms: Cspg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12032
Homologene: 7244
Jup
Name: junction plakoglobin
Synonyms: Ctnng, gamma-catenin, D930025P04Rik, PG, plakoglobin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Enpp6
Name: ectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms: 4833421B01Rik, Npp6, B830047L21Rik, D8Ertd514e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320981
Homologene: 62657
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
Crcp
Name: calcitonin gene-related peptide-receptor component protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12909
Homologene: 40587
Isoc1
Name: isochorismatase domain containing 1
Synonyms: 2610034N03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66307
VEGA: 18
Homologene: 9361
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Dcun1d5
Name: defective in cullin neddylation 1 domain containing 5
Synonyms: 3110001A18Rik, D430047L21Rik, 4833420K19Rik, DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76863
VEGA: 9
Homologene: 9028
Pfdn5
Name: prefoldin 5
Synonyms: 1190001O17Rik, c-myc binding protein MM-1, MM-1, D15Ertd697e, 1700010A06Rik, EIG-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56612
HGNC: HGNC:8869
Homologene: 1972
Zfc3h1
Name: zinc finger, C3H1-type containing
Synonyms: Ccdc131, Psrc2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216345
Homologene: 17017
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Haus3
Name: HAUS augmin-like complex, subunit 3
Synonyms: D4S43h, D5H4S43, D5H4S43E
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231123
Homologene: 75209
Klrg1
Name: killer cell lectin-like receptor subfamily G, member 1
Synonyms: 2F1-Ag
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50928
HGNC: HGNC:6380
Homologene: 4244
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Ints10
Name: integrator complex subunit 10
Synonyms: 4921521J11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70885
Homologene: 10029
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: E230025N21Rik, N-3 kinesin, Kif16a, 4831403C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Ceacam12
Name: CEA cell adhesion molecule 12
Synonyms: Ceacam12-C3, 1600031J20Rik, Ceacam12-C1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67315
Homologene: 137375
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Nxpe5
Name: neurexophilin and PC-esterase domain family, member 5
Synonyms: Fam55 related, BC055004
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381680
Homologene: 134143
Tmem132c
Name: transmembrane protein 132C
Synonyms: 2810482M11Rik, 4632425D07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208213
Homologene: 76567
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Vmn1r27
Name: vomeronasal 1 receptor 27
Synonyms: V1rc33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171206
Homologene: 79462
Tbrg1
Name: transforming growth factor beta regulated gene 1
Synonyms: TB-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21376
Homologene: 18102
Hinfp
Name: histone H4 transcription factor
Synonyms: DKFZp434F162, Mizf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102423
VEGA: 9
Homologene: 9174
Or10q1
Name: olfactory receptor family 10 subfamily Q member 1
Synonyms: Olfr1494, GA_x6K02T2RE5P-4082427-4083374, MOR266-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258992
Homologene: 64855
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: TPRBK, 2310015L07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106347
Homologene: 15892
Zfp800
Name: zinc finger protein 800
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 627049
Homologene: 18529
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Cdk15
Name: cyclin dependent kinase 15
Synonyms: Pftk2, Als2cr7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271697
Homologene: 64641
Ttbk2
Name: tau tubulin kinase 2
Synonyms: 2610507N02Rik, B930008N24Rik, TTK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Itm2c
Name: integral membrane protein 2C
Synonyms: Bricd2c, BRI3, ITM3, 3110038L02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64294
HGNC: HGNC:6175
Homologene: 11186
Marchf1
Name: membrane associated ring-CH-type finger 1
Synonyms: 2900024D24Rik, March1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72925
Homologene: 113749
Dsc1
Name: desmocollin 1
Synonyms: Dsc1a, Dsc1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Map3k3
Name: mitogen-activated protein kinase kinase kinase 3
Synonyms: MAPKKK3, Mekk3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26406
HGNC: HGNC:6855
Homologene: 69110
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: Psg30, 1600029H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Dnajc25
Name: DnaJ heat shock protein family (Hsp40) member C25
Synonyms: 2010109C08Rik, 2010203O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72429
Homologene: 37883
Hs3st5
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Synonyms: D930005L05Rik, LOC382362
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319415
Homologene: 17796
Actr1b
Name: ARP1 actin-related protein 1B, centractin beta
Synonyms: 2310066K23Rik, Arp1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226977
HGNC: HGNC:168
Homologene: 101541
Gipr
Name: gastric inhibitory polypeptide receptor
Synonyms: LOC381853, LOC232937, glucose-dependent insulinotropic polypeptide receptor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381853
HGNC: HGNC:4271
Homologene: 20081
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Tapbpl
Name: TAP binding protein-like
Synonyms: TAPBPL-R
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213233
Homologene: 9958
Zfp260
Name: zinc finger protein 260
Synonyms: Ozrf1, PEX1, Zfp63
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26466
Homologene: 40802
Flvcr2
Name: feline leukemia virus subgroup C cellular receptor 2
Synonyms: CCT, Mfsd7c
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217721
VEGA: 12
Homologene: 9840
Prr23a4
Name: proline rich 23A, member 4
Synonyms: 7420426K07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546157
Homologene: 133110
Tmem219
Name: transmembrane protein 219
Synonyms: 2900045G02Rik, 1110032O16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68742
Homologene: 19263
Ighv1-31
Name: immunoglobulin heavy variable 1-31
Synonyms: Gm16965
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629893
Crls1
Name: cardiolipin synthase 1
Synonyms: 0610009I22Rik, 4930557M15Rik, 5730490M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66586
Homologene: 32438
Ighv5-15
Name: immunoglobulin heavy variable 5-15
Synonyms: Gm16888
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780792
HGNC: HGNC:5620
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 36,702,480 bp (GRCm38)
  • T to C, chromosome 1 at 53,504,315 bp (GRCm38)
  • T to C, chromosome 1 at 59,330,983 bp (GRCm38)
  • C to T, chromosome 1 at 85,905,334 bp (GRCm38)
  • T to C, chromosome 1 at 179,043,905 bp (GRCm38)
  • T to G, chromosome 2 at 82,992,412 bp (GRCm38)
  • T to A, chromosome 2 at 120,664,939 bp (GRCm38)
  • T to A, chromosome 2 at 120,773,285 bp (GRCm38)
  • T to A, chromosome 2 at 132,865,882 bp (GRCm38)
  • A to G, chromosome 2 at 157,469,888 bp (GRCm38)
  • G to T, chromosome 3 at 87,988,303 bp (GRCm38)
  • A to T, chromosome 3 at 142,829,257 bp (GRCm38)
  • T to C, chromosome 4 at 11,303,343 bp (GRCm38)
  • T to A, chromosome 4 at 59,003,394 bp (GRCm38)
  • A to T, chromosome 5 at 9,140,399 bp (GRCm38)
  • A to G, chromosome 5 at 24,400,116 bp (GRCm38)
  • A to T, chromosome 5 at 34,163,658 bp (GRCm38)
  • A to G, chromosome 5 at 74,546,802 bp (GRCm38)
  • G to A, chromosome 5 at 109,294,087 bp (GRCm38)
  • A to T, chromosome 5 at 111,183,207 bp (GRCm38)
  • G to A, chromosome 5 at 127,563,081 bp (GRCm38)
  • A to G, chromosome 5 at 130,059,823 bp (GRCm38)
  • A to G, chromosome 5 at 137,633,691 bp (GRCm38)
  • A to T, chromosome 5 at 138,251,183 bp (GRCm38)
  • G to A, chromosome 6 at 23,045,707 bp (GRCm38)
  • T to C, chromosome 6 at 23,078,857 bp (GRCm38)
  • A to T, chromosome 6 at 28,256,434 bp (GRCm38)
  • A to T, chromosome 6 at 58,215,761 bp (GRCm38)
  • A to G, chromosome 6 at 121,771,787 bp (GRCm38)
  • A to C, chromosome 6 at 122,279,740 bp (GRCm38)
  • A to G, chromosome 6 at 125,226,709 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • T to C, chromosome 6 at 146,996,809 bp (GRCm38)
  • T to C, chromosome 7 at 17,747,342 bp (GRCm38)
  • C to T, chromosome 7 at 18,069,304 bp (GRCm38)
  • T to A, chromosome 7 at 19,162,938 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • C to A, chromosome 7 at 30,104,807 bp (GRCm38)
  • T to A, chromosome 7 at 41,650,284 bp (GRCm38)
  • C to T, chromosome 7 at 126,896,845 bp (GRCm38)
  • G to A, chromosome 8 at 47,053,592 bp (GRCm38)
  • C to A, chromosome 8 at 66,468,493 bp (GRCm38)
  • C to T, chromosome 8 at 68,819,315 bp (GRCm38)
  • A to G, chromosome 9 at 7,206,780 bp (GRCm38)
  • G to A, chromosome 9 at 37,652,649 bp (GRCm38)
  • A to C, chromosome 9 at 44,297,786 bp (GRCm38)
  • A to G, chromosome 9 at 98,903,425 bp (GRCm38)
  • G to A, chromosome 9 at 107,517,603 bp (GRCm38)
  • A to T, chromosome 10 at 36,832,702 bp (GRCm38)
  • A to G, chromosome 10 at 76,423,126 bp (GRCm38)
  • A to T, chromosome 10 at 115,385,318 bp (GRCm38)
  • T to A, chromosome 11 at 80,094,268 bp (GRCm38)
  • C to T, chromosome 11 at 100,379,565 bp (GRCm38)
  • C to T, chromosome 11 at 106,142,509 bp (GRCm38)
  • T to A, chromosome 12 at 35,101,049 bp (GRCm38)
  • T to C, chromosome 12 at 85,747,021 bp (GRCm38)
  • C to T, chromosome 12 at 91,567,818 bp (GRCm38)
  • T to A, chromosome 12 at 113,826,737 bp (GRCm38)
  • T to C, chromosome 12 at 114,829,274 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • T to C, chromosome 15 at 102,326,851 bp (GRCm38)
  • G to A, chromosome 16 at 36,722,359 bp (GRCm38)
  • A to G, chromosome 17 at 21,722,054 bp (GRCm38)
  • A to T, chromosome 18 at 20,088,432 bp (GRCm38)
  • G to T, chromosome 18 at 58,659,685 bp (GRCm38)
  • C to T, chromosome 19 at 13,749,705 bp (GRCm38)
  • T to C, chromosome 19 at 37,411,444 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9372 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069180-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.