Strain Name:
C57BL/6J-MtgxR9373Btlr/Mmmh
Stock Number:
069181-MU
Citation ID:
RRID:MMRRC_069181-MU
Other Names:
R9373 (G1)
Major Collection:

Strain Information

Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Mapk1
Name: mitogen-activated protein kinase 1
Synonyms: p42mapk, MAPK2, Prkm1, Erk2, 9030612K14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26413
HGNC: HGNC:6871
Homologene: 37670
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Parvb
Name: parvin, beta
Synonyms: D15Gsk1, affixin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170736
Homologene: 8342
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Cd72
Name: CD72 antigen
Synonyms: Ly-32, Ly-m19, Ly-19, Lyb-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12517
HGNC: HGNC:1696
Homologene: 1350
Dnaaf4
Name: dynein axonemal assembly factor 4
Synonyms: EKN1, 1700010I24Rik, b2b811Clo, Dyx1c1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67685
Homologene: 12173
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, ETR-3, B230345P09Rik, Cugbp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Nelfb
Name: negative elongation factor complex member B
Synonyms: A730008L03Rik, Cobra1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58202
Homologene: 121600
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Clvs2
Name: clavesin 2
Synonyms: A330019N05Rik, Rlbp1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215890
Homologene: 27894
Me2
Name: malic enzyme 2, NAD(+)-dependent, mitochondrial
Synonyms: D030040L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107029
VEGA: 18
HGNC: HGNC:6984
Homologene: 37615
Foxp2
Name: forkhead box P2
Synonyms: 2810043D05Rik, D0Kist7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Or8b50
Name: olfactory receptor family 8 subfamily B member 50
Synonyms: GA_x6K02T2PVTD-32308823-32309773, MOR165-7, Olfr914
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258782
VEGA: 9
Homologene: 115511
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Adal
Name: adenosine deaminase-like
Synonyms: 4930578F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75894
Homologene: 13827
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210510
Homologene: 19364
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Vwc2l
Name: von Willebrand factor C domain-containing protein 2-like
Synonyms: brorin-like, Brl, A830006F12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320460
Homologene: 27945
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Spem1
Name: spermatid maturation 1
Synonyms: 1700095G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74288
Homologene: 45717
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Or5b118
Name: olfactory receptor family 5 subfamily B member 118
Synonyms: GA_x6K02T2RE5P-3803583-3804527, MOR202-42, MOR202-26P, Olfr1474
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258123
Homologene: 79417
C9orf72
Name: C9orf72, member of C9orf72-SMCR8 complex
Synonyms: 3110043O21Rik, Dennd9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73205
Homologene: 10137
Wdr27
Name: WD repeat domain 27
Synonyms: 0610012K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71682
VEGA: 17
Homologene: 18417
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Or9g3
Name: olfactory receptor family 9 subfamily G member 3
Synonyms: GA_x6K02T2Q125-47239120-47238185, MOR213-6, Olfr1012
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258561
Homologene: 64889
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Acox1
Name: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: Acyl-CoA oxidase, AOX, D130055E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11430
HGNC: HGNC:119
Homologene: 38299
Epdr1
Name: ependymin related 1
Synonyms: MERP-1, MERP2, Ucc1, MERP-2, Epdr1, Epdr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105298
VEGA: 13
Homologene: 9714
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: 2310069I04Rik, 5730442P18Rik, Sh3d20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544817
Homologene: 45715
Or8b9
Name: olfactory receptor family 8 subfamily B member 9
Synonyms: GA_x6K02T2PVTD-31540342-31541277, MOR161-5, Olfr877
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258412
Homologene: 121556
Ajap1
Name: adherens junction associated protein 1
Synonyms: LOC230959
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230959
Homologene: 10312
Alg1
Name: ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase
Synonyms: HMT1, HMAT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208211
Homologene: 5387
2310003L06Rik
Name: RIKEN cDNA 2310003L06 gene
Type: Gene
Species: Mouse
Chromosome: 5
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: H2RSP, HAI-2 related small protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Runx3
Name: runt related transcription factor 3
Synonyms: AML2, Cbfa3, Rx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12399
Homologene: 37914
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 70,729,059 bp (GRCm38)
  • A to G, chromosome 1 at 107,547,019 bp (GRCm38)
  • G to T, chromosome 2 at 6,547,104 bp (GRCm38)
  • G to A, chromosome 2 at 14,270,188 bp (GRCm38)
  • G to A, chromosome 2 at 25,205,206 bp (GRCm38)
  • A to G, chromosome 2 at 66,483,917 bp (GRCm38)
  • A to T, chromosome 2 at 85,759,931 bp (GRCm38)
  • A to G, chromosome 2 at 121,150,222 bp (GRCm38)
  • G to T, chromosome 2 at 181,240,948 bp (GRCm38)
  • T to A, chromosome 3 at 76,648,362 bp (GRCm38)
  • A to T, chromosome 3 at 90,008,280 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to A, chromosome 3 at 144,966,372 bp (GRCm38)
  • A to G, chromosome 4 at 35,196,985 bp (GRCm38)
  • T to C, chromosome 4 at 43,450,141 bp (GRCm38)
  • T to C, chromosome 4 at 100,974,870 bp (GRCm38)
  • A to G, chromosome 4 at 135,121,145 bp (GRCm38)
  • C to T, chromosome 4 at 153,432,213 bp (GRCm38)
  • A to C, chromosome 5 at 87,972,809 bp (GRCm38)
  • A to G, chromosome 5 at 137,664,214 bp (GRCm38)
  • A to G, chromosome 6 at 15,377,970 bp (GRCm38)
  • A to C, chromosome 6 at 107,568,504 bp (GRCm38)
  • T to C, chromosome 7 at 4,757,713 bp (GRCm38)
  • T to A, chromosome 7 at 10,715,199 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 110,945,831 bp (GRCm38)
  • C to T, chromosome 8 at 48,299,655 bp (GRCm38)
  • T to C, chromosome 9 at 3,454,718 bp (GRCm38)
  • T to A, chromosome 9 at 37,855,454 bp (GRCm38)
  • G to A, chromosome 9 at 38,606,846 bp (GRCm38)
  • A to G, chromosome 9 at 72,964,180 bp (GRCm38)
  • A to G, chromosome 9 at 111,365,191 bp (GRCm38)
  • A to T, chromosome 10 at 33,528,386 bp (GRCm38)
  • G to A, chromosome 10 at 53,690,019 bp (GRCm38)
  • C to T, chromosome 10 at 67,096,716 bp (GRCm38)
  • C to T, chromosome 11 at 36,039,886 bp (GRCm38)
  • C to T, chromosome 11 at 69,821,814 bp (GRCm38)
  • C to T, chromosome 11 at 100,379,565 bp (GRCm38)
  • G to T, chromosome 11 at 103,360,461 bp (GRCm38)
  • A to T, chromosome 11 at 116,174,347 bp (GRCm38)
  • T to C, chromosome 11 at 120,015,517 bp (GRCm38)
  • T to C, chromosome 13 at 19,594,537 bp (GRCm38)
  • T to C, chromosome 13 at 59,796,867 bp (GRCm38)
  • AGTGCGGGAAAGGTTTCCACCTG to AG, chromosome 15 at 76,890,598 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • C to T, chromosome 15 at 84,303,899 bp (GRCm38)
  • T to C, chromosome 15 at 98,066,554 bp (GRCm38)
  • T to C, chromosome 16 at 5,239,126 bp (GRCm38)
  • A to G, chromosome 16 at 17,018,290 bp (GRCm38)
  • G to A, chromosome 17 at 14,934,533 bp (GRCm38)
  • A to G, chromosome 17 at 43,628,162 bp (GRCm38)
  • T to C, chromosome 18 at 73,785,729 bp (GRCm38)
  • A to G, chromosome 19 at 13,471,852 bp (GRCm38)
  • A to G, chromosome 19 at 17,122,138 bp (GRCm38)
  • G to A, chromosome 19 at 40,795,723 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9373 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.