Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9373Btlr/Mmmh
Stock Number:
069181-MU
Citation ID:
RRID:MMRRC_069181-MU
Other Names:
R9373 (G1)
Major Collection:

Strain Information

Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Mapk1
Name: mitogen-activated protein kinase 1
Synonyms: p42mapk, MAPK2, Prkm1, Erk2, 9030612K14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26413
HGNC: HGNC:6871
Homologene: 37670
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 70,729,059 bp (GRCm38)
  • A to G, chromosome 1 at 107,547,019 bp (GRCm38)
  • G to T, chromosome 2 at 6,547,104 bp (GRCm38)
  • G to A, chromosome 2 at 14,270,188 bp (GRCm38)
  • G to A, chromosome 2 at 25,205,206 bp (GRCm38)
  • A to G, chromosome 2 at 66,483,917 bp (GRCm38)
  • A to T, chromosome 2 at 85,759,931 bp (GRCm38)
  • A to G, chromosome 2 at 121,150,222 bp (GRCm38)
  • G to T, chromosome 2 at 181,240,948 bp (GRCm38)
  • T to A, chromosome 3 at 76,648,362 bp (GRCm38)
  • A to T, chromosome 3 at 90,008,280 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to A, chromosome 3 at 144,966,372 bp (GRCm38)
  • A to G, chromosome 4 at 35,196,985 bp (GRCm38)
  • T to C, chromosome 4 at 43,450,141 bp (GRCm38)
  • T to C, chromosome 4 at 100,974,870 bp (GRCm38)
  • A to G, chromosome 4 at 135,121,145 bp (GRCm38)
  • C to T, chromosome 4 at 153,432,213 bp (GRCm38)
  • A to C, chromosome 5 at 87,972,809 bp (GRCm38)
  • A to G, chromosome 5 at 137,664,214 bp (GRCm38)
  • A to G, chromosome 6 at 15,377,970 bp (GRCm38)
  • A to C, chromosome 6 at 107,568,504 bp (GRCm38)
  • T to C, chromosome 7 at 4,757,713 bp (GRCm38)
  • T to A, chromosome 7 at 10,715,199 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to G, chromosome 7 at 110,945,831 bp (GRCm38)
  • C to T, chromosome 8 at 48,299,655 bp (GRCm38)
  • T to C, chromosome 9 at 3,454,718 bp (GRCm38)
  • T to A, chromosome 9 at 37,855,454 bp (GRCm38)
  • G to A, chromosome 9 at 38,606,846 bp (GRCm38)
  • A to G, chromosome 9 at 72,964,180 bp (GRCm38)
  • A to G, chromosome 9 at 111,365,191 bp (GRCm38)
  • A to T, chromosome 10 at 33,528,386 bp (GRCm38)
  • G to A, chromosome 10 at 53,690,019 bp (GRCm38)
  • C to T, chromosome 10 at 67,096,716 bp (GRCm38)
  • C to T, chromosome 11 at 36,039,886 bp (GRCm38)
  • C to T, chromosome 11 at 69,821,814 bp (GRCm38)
  • C to T, chromosome 11 at 100,379,565 bp (GRCm38)
  • G to T, chromosome 11 at 103,360,461 bp (GRCm38)
  • A to T, chromosome 11 at 116,174,347 bp (GRCm38)
  • T to C, chromosome 11 at 120,015,517 bp (GRCm38)
  • T to C, chromosome 13 at 19,594,537 bp (GRCm38)
  • T to C, chromosome 13 at 59,796,867 bp (GRCm38)
  • AGTGCGGGAAAGGTTTCCACCTG to AG, chromosome 15 at 76,890,598 bp (GRCm38)
  • TGCGGGAAAGGTTTCCACCTGAGCG to TGCG, chromosome 15 at 76,890,600 bp (GRCm38)
  • C to T, chromosome 15 at 84,303,899 bp (GRCm38)
  • T to C, chromosome 15 at 98,066,554 bp (GRCm38)
  • T to C, chromosome 16 at 5,239,126 bp (GRCm38)
  • A to G, chromosome 16 at 17,018,290 bp (GRCm38)
  • G to A, chromosome 17 at 14,934,533 bp (GRCm38)
  • A to G, chromosome 17 at 43,628,162 bp (GRCm38)
  • T to C, chromosome 18 at 73,785,729 bp (GRCm38)
  • A to G, chromosome 19 at 13,471,852 bp (GRCm38)
  • A to G, chromosome 19 at 17,122,138 bp (GRCm38)
  • G to A, chromosome 19 at 40,795,723 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9373 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.