Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9380Btlr/Mmmh
Stock Number:
069188-MU
Citation ID:
RRID:MMRRC_069188-MU
Other Names:
R9380 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Kl
Name: klotho
Synonyms: alpha-kl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16591
HGNC: HGNC:6344
Homologene: 68415
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Ewsr1
Name: Ewing sarcoma breakpoint region 1
Synonyms: Ews
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14030
HGNC: HGNC:3508
Homologene: 134632
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Chuk
Name: conserved helix-loop-helix ubiquitous kinase
Synonyms: Chuk1, IKK1, IKK[a], IKK-alpha, IkappaB kinase alpha, IKK 1, IKK alpha, IKKalpha, IKK-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12675
HGNC: HGNC:1974
Homologene: 979
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to G, chromosome 1 at 78,681,885 bp (GRCm38)
  • A to G, chromosome 1 at 161,818,505 bp (GRCm38)
  • T to A, chromosome 1 at 172,325,880 bp (GRCm38)
  • A to T, chromosome 2 at 30,348,613 bp (GRCm38)
  • G to A, chromosome 2 at 34,839,017 bp (GRCm38)
  • A to T, chromosome 2 at 59,835,452 bp (GRCm38)
  • A to T, chromosome 2 at 88,768,186 bp (GRCm38)
  • G to A, chromosome 2 at 104,789,346 bp (GRCm38)
  • C to A, chromosome 2 at 119,270,123 bp (GRCm38)
  • T to C, chromosome 2 at 156,078,801 bp (GRCm38)
  • A to G, chromosome 3 at 19,674,395 bp (GRCm38)
  • A to G, chromosome 3 at 94,702,347 bp (GRCm38)
  • T to C, chromosome 3 at 98,712,137 bp (GRCm38)
  • A to T, chromosome 4 at 44,066,807 bp (GRCm38)
  • A to G, chromosome 4 at 53,693,991 bp (GRCm38)
  • A to G, chromosome 4 at 59,913,867 bp (GRCm38)
  • G to T, chromosome 4 at 63,662,613 bp (GRCm38)
  • A to G, chromosome 4 at 134,507,039 bp (GRCm38)
  • G to T, chromosome 4 at 140,702,391 bp (GRCm38)
  • A to C, chromosome 5 at 24,534,105 bp (GRCm38)
  • A to G, chromosome 5 at 105,327,336 bp (GRCm38)
  • A to G, chromosome 5 at 144,833,171 bp (GRCm38)
  • T to A, chromosome 5 at 150,988,877 bp (GRCm38)
  • T to C, chromosome 6 at 35,052,930 bp (GRCm38)
  • T to C, chromosome 6 at 48,933,130 bp (GRCm38)
  • C to A, chromosome 6 at 118,128,879 bp (GRCm38)
  • A to G, chromosome 6 at 131,689,418 bp (GRCm38)
  • C to G, chromosome 7 at 23,321,330 bp (GRCm38)
  • T to C, chromosome 7 at 44,715,388 bp (GRCm38)
  • G to A, chromosome 7 at 66,278,583 bp (GRCm38)
  • T to C, chromosome 7 at 80,391,758 bp (GRCm38)
  • T to C, chromosome 7 at 102,563,785 bp (GRCm38)
  • A to T, chromosome 7 at 112,841,898 bp (GRCm38)
  • T to A, chromosome 7 at 130,625,041 bp (GRCm38)
  • A to T, chromosome 8 at 3,603,999 bp (GRCm38)
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp (GRCm38)
  • C to A, chromosome 8 at 110,563,872 bp (GRCm38)
  • T to G, chromosome 8 at 119,956,204 bp (GRCm38)
  • G to T, chromosome 9 at 21,976,827 bp (GRCm38)
  • A to G, chromosome 9 at 38,607,119 bp (GRCm38)
  • T to C, chromosome 9 at 50,558,286 bp (GRCm38)
  • A to T, chromosome 9 at 80,381,795 bp (GRCm38)
  • G to A, chromosome 9 at 88,731,882 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • A to G, chromosome 9 at 110,392,513 bp (GRCm38)
  • A to G, chromosome 9 at 111,392,670 bp (GRCm38)
  • T to A, chromosome 10 at 111,273,119 bp (GRCm38)
  • T to C, chromosome 11 at 5,093,730 bp (GRCm38)
  • A to T, chromosome 11 at 45,852,161 bp (GRCm38)
  • A to G, chromosome 11 at 49,564,077 bp (GRCm38)
  • T to C, chromosome 11 at 60,715,471 bp (GRCm38)
  • A to T, chromosome 11 at 67,746,746 bp (GRCm38)
  • A to T, chromosome 11 at 70,316,168 bp (GRCm38)
  • A to G, chromosome 11 at 72,442,842 bp (GRCm38)
  • A to T, chromosome 11 at 86,286,772 bp (GRCm38)
  • T to C, chromosome 11 at 114,745,163 bp (GRCm38)
  • T to A, chromosome 11 at 115,124,327 bp (GRCm38)
  • C to T, chromosome 11 at 116,331,721 bp (GRCm38)
  • A to G, chromosome 12 at 70,028,031 bp (GRCm38)
  • G to T, chromosome 13 at 21,180,510 bp (GRCm38)
  • A to T, chromosome 13 at 34,166,097 bp (GRCm38)
  • A to C, chromosome 13 at 43,200,844 bp (GRCm38)
  • T to A, chromosome 13 at 104,144,199 bp (GRCm38)
  • T to C, chromosome 14 at 21,628,858 bp (GRCm38)
  • T to C, chromosome 14 at 34,352,000 bp (GRCm38)
  • C to A, chromosome 14 at 50,140,313 bp (GRCm38)
  • A to G, chromosome 14 at 64,029,026 bp (GRCm38)
  • T to A, chromosome 14 at 73,590,872 bp (GRCm38)
  • G to A, chromosome 15 at 79,763,589 bp (GRCm38)
  • T to C, chromosome 15 at 81,616,044 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to G, chromosome 17 at 22,454,699 bp (GRCm38)
  • T to A, chromosome 17 at 24,550,288 bp (GRCm38)
  • T to C, chromosome 17 at 34,958,194 bp (GRCm38)
  • A to T, chromosome 17 at 71,749,356 bp (GRCm38)
  • G to A, chromosome 18 at 61,064,848 bp (GRCm38)
  • A to G, chromosome 19 at 24,379,053 bp (GRCm38)
  • T to A, chromosome 19 at 27,238,792 bp (GRCm38)
  • C to A, chromosome 19 at 44,074,519 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9380 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069188-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.