Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9386Btlr/Mmmh
Stock Number:
069192-MU
Citation ID:
RRID:MMRRC_069192-MU
Other Names:
R9386 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Cdk18
Name: cyclin dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Fbxo15
Name: F-box protein 15
Synonyms: Fbx15, ecat3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Nopchap1
Name: NOP protein chaperone 1
Synonyms: C430041I18Rik, D10Wsu102e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28109
Homologene: 17547
Cntnap1
Name: contactin associated protein-like 1
Synonyms: p190, Caspr, Nrxn4, NCP1, paranodin, shm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53321
HGNC: HGNC:8011
Homologene: 2693
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Eloa
Name: elongin A
Synonyms: Tceb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27224
Homologene: 37746
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Tsc1
Name: TSC complex subunit 1
Synonyms: hamartin, tuberous sclerosis 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64930
Homologene: 314
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Klhl26
Name: kelch-like 26
Synonyms: C630013N10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234378
Homologene: 41247
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Siglech
Name: sialic acid binding Ig-like lectin H
Synonyms: Siglec-H, 6430529G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233274
HGNC: HGNC:1659
Homologene: 48041
Mex3a
Name: mex3 RNA binding family member A
Synonyms: Rkhd4, 2700083E18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72640
Homologene: 18950
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Epb41l4b
Name: erythrocyte membrane protein band 4.1 like 4b
Synonyms: Ehm2, D4Ertd346e, 6430543G08Rik, Lulu2, Epb4.1l4b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54357
Homologene: 69270
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Or13n4
Name: olfactory receptor family 13 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-9202245-9201289, MOR260-4, Olfr702
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258590
Homologene: 121512
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: 5730405L21Rik, Galntl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: 6030457M03Rik, CTF18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214901
Homologene: 32532
Tmem175
Name: transmembrane protein 175
Synonyms: 3010001K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72392
Homologene: 12461
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Vsig10
Name: V-set and immunoglobulin domain containing 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231668
Homologene: 10414
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Pxmp4
Name: peroxisomal membrane protein 4
Synonyms: 3010018P03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59038
Homologene: 5237
Aoc1l1
Name: amine oxidase copper containing 1-like 1
Synonyms: Doxl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243376
HGNC: HGNC:80
Homologene: 19443
Ing2
Name: inhibitor of growth family, member 2
Synonyms: P33ING2, 2810011M06Rik, ING2, Ing1l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69260
HGNC: HGNC:6063
Homologene: 20388
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Plekha8
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231999
Homologene: 32284
Hcfc2
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67933
Homologene: 8337
Haus6
Name: HAUS augmin-like complex, subunit 6
Synonyms: D4Ertd27e, 6230416J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230376
Homologene: 9760
Unc93a2
Name: unc-93 homolog A2
Synonyms: Gm9992
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 667055
VEGA: 17
Homologene: 10356
Alg1
Name: ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase
Synonyms: HMT1, HMAT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208211
Homologene: 5387
Tpm3-rs7
Name: tropomyosin 3, related sequence 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 621054
VEGA: 14
Hoxd13
Name: homeobox D13
Synonyms: Hox-4.8, spdh
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15433
HGNC: HGNC:5136
Homologene: 20147
Lce1a1
Name: late cornified envelope 1A1
Synonyms: 2200008B06Rik, Sprrl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67127
Trav8d-2
Name: T cell receptor alpha variable 8D-2
Synonyms: Gm8721
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667604
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 66,725,970 bp (GRCm38)
  • A to G, chromosome 1 at 132,116,445 bp (GRCm38)
  • T to C, chromosome 2 at 28,671,846 bp (GRCm38)
  • T to C, chromosome 2 at 32,214,113 bp (GRCm38)
  • A to T, chromosome 2 at 41,123,628 bp (GRCm38)
  • A to G, chromosome 2 at 74,668,983 bp (GRCm38)
  • C to T, chromosome 2 at 121,367,730 bp (GRCm38)
  • A to C, chromosome 2 at 128,617,722 bp (GRCm38)
  • C to A, chromosome 2 at 154,588,084 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • A to G, chromosome 3 at 88,536,198 bp (GRCm38)
  • T to G, chromosome 3 at 92,646,883 bp (GRCm38)
  • A to T, chromosome 3 at 93,447,039 bp (GRCm38)
  • G to A, chromosome 3 at 95,488,376 bp (GRCm38)
  • A to T, chromosome 4 at 57,076,553 bp (GRCm38)
  • A to G, chromosome 4 at 86,583,864 bp (GRCm38)
  • G to A, chromosome 4 at 101,636,901 bp (GRCm38)
  • A to G, chromosome 4 at 136,010,536 bp (GRCm38)
  • G to A, chromosome 4 at 154,256,077 bp (GRCm38)
  • A to T, chromosome 5 at 73,191,809 bp (GRCm38)
  • A to T, chromosome 5 at 108,639,473 bp (GRCm38)
  • A to C, chromosome 5 at 117,325,075 bp (GRCm38)
  • G to A, chromosome 5 at 124,794,443 bp (GRCm38)
  • A to G, chromosome 6 at 48,975,390 bp (GRCm38)
  • C to A, chromosome 6 at 54,628,861 bp (GRCm38)
  • T to C, chromosome 7 at 55,772,564 bp (GRCm38)
  • T to C, chromosome 7 at 106,824,500 bp (GRCm38)
  • A to T, chromosome 7 at 141,693,146 bp (GRCm38)
  • T to C, chromosome 8 at 3,521,417 bp (GRCm38)
  • T to C, chromosome 8 at 47,674,526 bp (GRCm38)
  • A to G, chromosome 8 at 70,451,506 bp (GRCm38)
  • T to C, chromosome 8 at 110,587,730 bp (GRCm38)
  • C to A, chromosome 9 at 6,293,903 bp (GRCm38)
  • A to T, chromosome 9 at 7,503,387 bp (GRCm38)
  • A to T, chromosome 9 at 67,365,967 bp (GRCm38)
  • T to A, chromosome 10 at 10,398,964 bp (GRCm38)
  • T to A, chromosome 10 at 82,739,103 bp (GRCm38)
  • T to C, chromosome 10 at 83,360,265 bp (GRCm38)
  • T to G, chromosome 10 at 86,713,026 bp (GRCm38)
  • T to A, chromosome 11 at 65,947,542 bp (GRCm38)
  • T to A, chromosome 11 at 101,185,226 bp (GRCm38)
  • T to C, chromosome 12 at 4,629,730 bp (GRCm38)
  • G to A, chromosome 12 at 8,006,629 bp (GRCm38)
  • T to C, chromosome 12 at 80,598,106 bp (GRCm38)
  • T to A, chromosome 12 at 112,778,993 bp (GRCm38)
  • A to G, chromosome 13 at 49,067,346 bp (GRCm38)
  • C to T, chromosome 13 at 55,481,947 bp (GRCm38)
  • G to A, chromosome 14 at 53,042,763 bp (GRCm38)
  • A to C, chromosome 14 at 113,315,165 bp (GRCm38)
  • T to C, chromosome 15 at 71,981,945 bp (GRCm38)
  • T to C, chromosome 15 at 85,979,030 bp (GRCm38)
  • T to C, chromosome 16 at 5,241,337 bp (GRCm38)
  • T to G, chromosome 16 at 15,678,272 bp (GRCm38)
  • C to A, chromosome 16 at 52,166,338 bp (GRCm38)
  • T to C, chromosome 16 at 81,455,364 bp (GRCm38)
  • C to T, chromosome 17 at 7,369,765 bp (GRCm38)
  • C to T, chromosome 17 at 25,723,758 bp (GRCm38)
  • C to T, chromosome 17 at 28,053,906 bp (GRCm38)
  • A to G, chromosome 18 at 20,392,014 bp (GRCm38)
  • A to T, chromosome 18 at 84,959,247 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9386 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069192-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.