Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9401Btlr/Mmmh
Stock Number:
069205-MU
Citation ID:
RRID:MMRRC_069205-MU
Other Names:
R9401 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Fbxo22
Name: F-box protein 22
Synonyms: 1600016C16Rik, 0610033L19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71999
Homologene: 12433
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Smarcad1
Name: SNF2 related chromatin remodeling ATPase with DExD box 1
Synonyms: D6Pas1, Etl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13990
Homologene: 5301
Fzd8
Name: frizzled class receptor 8
Synonyms: Fz8, mFZ8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14370
VEGA: 18
HGNC: HGNC:4046
Homologene: 40606
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 25,553,702 bp (GRCm38)
  • C to T, chromosome 1 at 36,216,131 bp (GRCm38)
  • C to A, chromosome 1 at 53,528,867 bp (GRCm38)
  • C to A, chromosome 1 at 82,882,237 bp (GRCm38)
  • T to A, chromosome 1 at 88,139,160 bp (GRCm38)
  • A to T, chromosome 1 at 166,677,620 bp (GRCm38)
  • T to C, chromosome 2 at 37,332,281 bp (GRCm38)
  • A to T, chromosome 2 at 86,122,024 bp (GRCm38)
  • T to A, chromosome 2 at 120,935,284 bp (GRCm38)
  • T to G, chromosome 2 at 144,578,366 bp (GRCm38)
  • T to A, chromosome 2 at 150,409,695 bp (GRCm38)
  • T to A, chromosome 2 at 157,174,822 bp (GRCm38)
  • T to G, chromosome 2 at 173,106,088 bp (GRCm38)
  • C to T, chromosome 3 at 16,204,495 bp (GRCm38)
  • A to T, chromosome 3 at 36,621,354 bp (GRCm38)
  • A to G, chromosome 3 at 75,112,083 bp (GRCm38)
  • T to G, chromosome 3 at 98,456,503 bp (GRCm38)
  • T to A, chromosome 3 at 101,425,759 bp (GRCm38)
  • T to C, chromosome 3 at 103,777,979 bp (GRCm38)
  • A to G, chromosome 4 at 11,265,806 bp (GRCm38)
  • T to A, chromosome 4 at 34,654,819 bp (GRCm38)
  • C to A, chromosome 4 at 133,241,156 bp (GRCm38)
  • G to A, chromosome 5 at 67,749,149 bp (GRCm38)
  • C to T, chromosome 5 at 73,065,220 bp (GRCm38)
  • C to T, chromosome 5 at 89,179,666 bp (GRCm38)
  • T to A, chromosome 5 at 118,745,024 bp (GRCm38)
  • A to G, chromosome 5 at 147,078,678 bp (GRCm38)
  • T to A, chromosome 5 at 150,378,938 bp (GRCm38)
  • A to C, chromosome 6 at 6,863,581 bp (GRCm38)
  • T to C, chromosome 6 at 65,094,337 bp (GRCm38)
  • T to A, chromosome 6 at 69,700,983 bp (GRCm38)
  • T to A, chromosome 6 at 85,678,019 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • T to A, chromosome 6 at 142,598,110 bp (GRCm38)
  • A to G, chromosome 7 at 24,142,126 bp (GRCm38)
  • G to A, chromosome 7 at 29,776,872 bp (GRCm38)
  • T to A, chromosome 7 at 43,954,250 bp (GRCm38)
  • G to T, chromosome 7 at 44,994,250 bp (GRCm38)
  • T to A, chromosome 7 at 49,951,437 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • G to A, chromosome 8 at 70,771,093 bp (GRCm38)
  • A to G, chromosome 8 at 111,054,153 bp (GRCm38)
  • A to T, chromosome 8 at 120,086,686 bp (GRCm38)
  • A to G, chromosome 8 at 121,785,115 bp (GRCm38)
  • T to C, chromosome 9 at 36,923,745 bp (GRCm38)
  • T to A, chromosome 9 at 50,618,605 bp (GRCm38)
  • A to G, chromosome 9 at 55,223,344 bp (GRCm38)
  • T to C, chromosome 9 at 65,278,099 bp (GRCm38)
  • A to G, chromosome 10 at 41,267,737 bp (GRCm38)
  • T to C, chromosome 10 at 80,612,404 bp (GRCm38)
  • G to A, chromosome 10 at 102,512,508 bp (GRCm38)
  • A to G, chromosome 10 at 129,857,429 bp (GRCm38)
  • C to T, chromosome 11 at 100,865,428 bp (GRCm38)
  • T to C, chromosome 12 at 36,502,074 bp (GRCm38)
  • C to A, chromosome 12 at 54,916,554 bp (GRCm38)
  • C to T, chromosome 12 at 113,269,487 bp (GRCm38)
  • T to C, chromosome 13 at 59,742,198 bp (GRCm38)
  • T to A, chromosome 13 at 108,282,654 bp (GRCm38)
  • A to T, chromosome 14 at 31,161,112 bp (GRCm38)
  • T to A, chromosome 14 at 37,098,098 bp (GRCm38)
  • A to T, chromosome 14 at 56,211,356 bp (GRCm38)
  • A to T, chromosome 15 at 74,958,304 bp (GRCm38)
  • G to T, chromosome 15 at 86,033,085 bp (GRCm38)
  • T to C, chromosome 16 at 11,232,671 bp (GRCm38)
  • G to T, chromosome 16 at 23,972,357 bp (GRCm38)
  • T to A, chromosome 16 at 91,815,520 bp (GRCm38)
  • G to A, chromosome 17 at 20,502,649 bp (GRCm38)
  • A to C, chromosome 17 at 20,502,650 bp (GRCm38)
  • T to C, chromosome 17 at 23,401,592 bp (GRCm38)
  • AGAC to AGACGAC, chromosome 17 at 25,845,776 bp (GRCm38)
  • T to C, chromosome 17 at 31,583,778 bp (GRCm38)
  • A to G, chromosome 17 at 45,566,984 bp (GRCm38)
  • CCGC to CC, chromosome 17 at 78,350,865 bp (GRCm38)
  • T to A, chromosome 18 at 9,213,205 bp (GRCm38)
  • A to T, chromosome 19 at 27,398,936 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9401 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069205-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.