Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9410Btlr/Mmmh
Stock Number:
069214-MU
Citation ID:
RRID:MMRRC_069214-MU
Other Names:
R9410 (G1)
Major Collection:

Strain Information

Sulf2
Name: sulfatase 2
Synonyms: 2010004N24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72043
Homologene: 10313
Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Meis1
Name: Meis homeobox 1
Synonyms: C530044H18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17268
HGNC: HGNC:7000
Homologene: 86803
Tmprss12
Name: transmembrane (C-terminal) protease, serine 12
Synonyms: 4930478A21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75002
VEGA: 15
Homologene: 16598
Hcrtr1
Name: hypocretin (orexin) receptor 1
Synonyms: OX1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230777
HGNC: HGNC:4848
Homologene: 37492
Dgkh
Name: diacylglycerol kinase, eta
Synonyms: 5930402B05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380921
VEGA: 14
HGNC: HGNC:2854
Homologene: 99373
Stau1
Name: staufen double-stranded RNA binding protein 1
Synonyms: 5830401L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20853
Homologene: 3384
Appbp2
Name: amyloid beta precursor protein binding protein 2
Synonyms: PAT1, 1300003O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66884
HGNC: HGNC:622
Homologene: 31378
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Sumf1
Name: sulfatase modifying factor 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58911
Homologene: 16268
Cnr1
Name: cannabinoid receptor 1
Synonyms: CB1, CB1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Ctla4
Name: cytotoxic T-lymphocyte-associated protein 4
Synonyms: Ctla-4, Ly-56, Cd152
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12477
HGNC: HGNC:2505
Homologene: 3820
Tnfrsf10b
Name: tumor necrosis factor receptor superfamily, member 10b
Synonyms: Trail Receptor, Ly98, Killer/Dr5, DR5, TRICK2B, TRAILR2, TRICKB, TRAIL-R2, TRICK2A, KILLER
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21933
VEGA: 14
Homologene: 129806
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ctsa
Name: cathepsin A
Synonyms: PPCA, Ppgb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19025
HGNC: HGNC:9251
Homologene: 80163
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3p, SEC3, A730011E05Rik, 2810407P21Rik, Sec3l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69940
Homologene: 41241
Stag3
Name: STAG3 cohesin complex component
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50878
Homologene: 40844
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ruvbl2
Name: RuvB-like AAA ATPase 2
Synonyms: p47, mp47
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20174
Homologene: 4856
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Nuk, Tyro5, Prkm5, Erk, Drt, Hek5, Sek3, Qek5, Cek5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Mre11a
Name: MRE11A homolog A, double strand break repair nuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17535
HGNC: HGNC:7230
Homologene: 4083
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Abcb5
Name: ATP-binding cassette, sub-family B member 5
Synonyms: 9230106F14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77706
HGNC: HGNC:46
Homologene: 83488
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71774
Homologene: 12411
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Ndufa10
Name: NADH:ubiquinone oxidoreductase subunit A10
Synonyms: 2900053E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67273
HGNC: HGNC:7684
Homologene: 15342
Mfsd2b
Name: MFSD2 lysolipid transporter B, sphingolipid
Synonyms: major facilitator superfamily domain containing 2B, Gm1964
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432628
Homologene: 47753
Plin4
Name: perilipin 4
Synonyms: S3-12
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57435
Homologene: 69311
Zfp563
Name: zinc finger protein 563
Synonyms: zinc finger protein, Zfp413
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240068
Homologene: 77346
Rnf180
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: GA_x6K02T2PSCP-2779375-2780313, MOR256-7, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Slc22a2
Name: solute carrier family 22 (organic cation transporter), member 2
Synonyms: Oct2, Orct2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20518
VEGA: 17
Homologene: 68293
Rnf150
Name: ring finger protein 150
Synonyms: Greul5, A630007N06Rik, C030044C12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330812
Homologene: 33783
Vmn1r236
Name: vomeronasal 1 receptor 236
Synonyms: V1rf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171235
Odad1
Name: outer dynein arm docking complex subunit 1
Synonyms: Ccdc114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211535
Homologene: 128610
Fscn3
Name: fascin actin-bundling protein 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56223
HGNC: HGNC:3961
Homologene: 10475
Fpr2
Name: formyl peptide receptor 2
Synonyms: E330010I07Rik, Fpr-rs2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14289
HGNC: HGNC:3827
Homologene: 74395
Zfp189
Name: zinc finger protein 189
Synonyms: C430015I23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230162
Homologene: 20737
Krtap2-4
Name: keratin associated protein 2-4
Synonyms: KRTAP2.4, KAP2.4, 5530401P19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71453
Homologene: 41961
B020004C17Rik
Name: RIKEN cDNA B020004C17 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432860
VEGA: 14
Homologene: 128423
Faiml
Name: Fas apoptotic inhibitory molecule like
Synonyms: Gm6432
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 623459
Igkv4-62
Name: immunoglobulin kappa variable 4-62
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 636752
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 60,912,752 bp (GRCm38)
  • A to T, chromosome 1 at 92,439,892 bp (GRCm38)
  • C to T, chromosome 2 at 91,991,886 bp (GRCm38)
  • C to T, chromosome 2 at 144,482,130 bp (GRCm38)
  • T to A, chromosome 2 at 157,469,756 bp (GRCm38)
  • T to C, chromosome 2 at 164,835,181 bp (GRCm38)
  • A to C, chromosome 2 at 166,094,524 bp (GRCm38)
  • T to C, chromosome 2 at 166,955,118 bp (GRCm38)
  • G to A, chromosome 3 at 49,745,166 bp (GRCm38)
  • A to T, chromosome 3 at 108,075,274 bp (GRCm38)
  • A to G, chromosome 4 at 33,944,973 bp (GRCm38)
  • T to A, chromosome 4 at 49,529,942 bp (GRCm38)
  • A to T, chromosome 4 at 130,135,721 bp (GRCm38)
  • A to T, chromosome 4 at 136,659,637 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • T to A, chromosome 5 at 76,559,142 bp (GRCm38)
  • T to C, chromosome 5 at 138,299,339 bp (GRCm38)
  • GC to GCTCC, chromosome 6 at 4,756,452 bp (GRCm38)
  • C to T, chromosome 6 at 28,430,433 bp (GRCm38)
  • T to C, chromosome 6 at 69,399,848 bp (GRCm38)
  • A to C, chromosome 6 at 108,173,402 bp (GRCm38)
  • G to A, chromosome 7 at 45,422,194 bp (GRCm38)
  • T to C, chromosome 7 at 45,948,397 bp (GRCm38)
  • T to C, chromosome 8 at 83,036,093 bp (GRCm38)
  • G to A, chromosome 9 at 14,805,420 bp (GRCm38)
  • A to G, chromosome 9 at 75,116,214 bp (GRCm38)
  • C to A, chromosome 9 at 99,229,534 bp (GRCm38)
  • C to G, chromosome 9 at 108,611,739 bp (GRCm38)
  • CAGAGA to CAGA, chromosome 10 at 74,645,831 bp (GRCm38)
  • C to T, chromosome 11 at 18,883,987 bp (GRCm38)
  • T to A, chromosome 11 at 36,141,569 bp (GRCm38)
  • C to T, chromosome 11 at 53,463,390 bp (GRCm38)
  • A to T, chromosome 11 at 85,215,241 bp (GRCm38)
  • C to A, chromosome 11 at 99,614,611 bp (GRCm38)
  • T to A, chromosome 12 at 4,865,747 bp (GRCm38)
  • G to A, chromosome 12 at 118,905,968 bp (GRCm38)
  • CGAGG to CGAGGAGG, chromosome 13 at 105,250,273 bp (GRCm38)
  • C to A, chromosome 14 at 52,811,388 bp (GRCm38)
  • A to T, chromosome 14 at 57,016,816 bp (GRCm38)
  • T to G, chromosome 14 at 69,773,400 bp (GRCm38)
  • T to C, chromosome 14 at 78,624,853 bp (GRCm38)
  • A to C, chromosome 15 at 100,292,741 bp (GRCm38)
  • T to C, chromosome 17 at 12,586,845 bp (GRCm38)
  • C to T, chromosome 17 at 17,893,342 bp (GRCm38)
  • T to A, chromosome 17 at 21,287,494 bp (GRCm38)
  • T to C, chromosome 17 at 23,359,941 bp (GRCm38)
  • T to A, chromosome 17 at 33,102,346 bp (GRCm38)
  • A to T, chromosome 17 at 38,335,429 bp (GRCm38)
  • A to G, chromosome 17 at 56,106,995 bp (GRCm38)
  • A to T, chromosome 18 at 20,331,533 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9410 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069214-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.