Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9412Btlr/Mmmh
Stock Number:
069216-MU
Citation ID:
RRID:MMRRC_069216-MU
Other Names:
R9412 (G1)
Major Collection:

Strain Information

Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, p38IP, D3Ertd300e, Fam48a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56790
Homologene: 134155
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 105,734,563 bp (GRCm38)
  • T to C, chromosome 1 at 149,880,021 bp (GRCm38)
  • G to T, chromosome 2 at 53,117,004 bp (GRCm38)
  • A to G, chromosome 2 at 155,851,409 bp (GRCm38)
  • TCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCA, chromosome 3 at 54,727,648 bp (GRCm38)
  • C to T, chromosome 4 at 83,436,333 bp (GRCm38)
  • A to T, chromosome 4 at 108,557,364 bp (GRCm38)
  • A to G, chromosome 5 at 92,393,154 bp (GRCm38)
  • T to A, chromosome 5 at 108,843,618 bp (GRCm38)
  • C to T, chromosome 5 at 121,802,138 bp (GRCm38)
  • C to T, chromosome 5 at 124,083,690 bp (GRCm38)
  • C to CTCT, chromosome 6 at 4,756,453 bp (GRCm38)
  • G to A, chromosome 6 at 29,441,485 bp (GRCm38)
  • A to G, chromosome 6 at 120,389,030 bp (GRCm38)
  • T to C, chromosome 7 at 6,132,947 bp (GRCm38)
  • T to A, chromosome 7 at 32,101,202 bp (GRCm38)
  • T to A, chromosome 7 at 67,531,764 bp (GRCm38)
  • T to A, chromosome 7 at 68,207,253 bp (GRCm38)
  • T to A, chromosome 8 at 13,554,695 bp (GRCm38)
  • T to G, chromosome 8 at 41,287,751 bp (GRCm38)
  • A to G, chromosome 8 at 92,359,723 bp (GRCm38)
  • T to C, chromosome 9 at 15,997,407 bp (GRCm38)
  • C to T, chromosome 9 at 27,056,155 bp (GRCm38)
  • T to C, chromosome 9 at 73,932,490 bp (GRCm38)
  • T to C, chromosome 9 at 110,378,605 bp (GRCm38)
  • G to A, chromosome 9 at 111,482,751 bp (GRCm38)
  • T to C, chromosome 10 at 24,902,121 bp (GRCm38)
  • T to C, chromosome 10 at 50,649,134 bp (GRCm38)
  • T to C, chromosome 10 at 62,594,102 bp (GRCm38)
  • CAGAGA to CAGA, chromosome 10 at 74,645,831 bp (GRCm38)
  • T to A, chromosome 10 at 80,019,730 bp (GRCm38)
  • T to A, chromosome 10 at 127,573,418 bp (GRCm38)
  • T to A, chromosome 10 at 128,671,889 bp (GRCm38)
  • T to C, chromosome 11 at 86,226,763 bp (GRCm38)
  • C to A, chromosome 11 at 110,212,233 bp (GRCm38)
  • A to T, chromosome 11 at 121,841,953 bp (GRCm38)
  • G to A, chromosome 12 at 71,188,683 bp (GRCm38)
  • T to C, chromosome 12 at 84,608,807 bp (GRCm38)
  • C to A, chromosome 12 at 100,130,422 bp (GRCm38)
  • C to A, chromosome 13 at 33,150,248 bp (GRCm38)
  • C to A, chromosome 13 at 33,897,388 bp (GRCm38)
  • C to T, chromosome 13 at 73,648,927 bp (GRCm38)
  • T to A, chromosome 17 at 7,772,366 bp (GRCm38)
  • T to G, chromosome 17 at 17,733,951 bp (GRCm38)
  • C to T, chromosome 17 at 37,009,922 bp (GRCm38)
  • A to T, chromosome 17 at 38,335,429 bp (GRCm38)
  • A to T, chromosome 19 at 44,942,021 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069216-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.