Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9417Btlr/Mmmh
Stock Number:
069221-MU
Citation ID:
RRID:MMRRC_069221-MU
Other Names:
R9417 (G1)
Major Collection:

Strain Information

Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 157,107,219 bp (GRCm38)
  • A to G, chromosome 1 at 171,280,281 bp (GRCm38)
  • A to G, chromosome 2 at 30,983,018 bp (GRCm38)
  • A to G, chromosome 2 at 70,587,372 bp (GRCm38)
  • T to C, chromosome 2 at 145,844,793 bp (GRCm38)
  • T to A, chromosome 2 at 156,123,931 bp (GRCm38)
  • A to T, chromosome 3 at 59,329,105 bp (GRCm38)
  • T to C, chromosome 3 at 83,837,585 bp (GRCm38)
  • T to A, chromosome 4 at 19,662,215 bp (GRCm38)
  • T to C, chromosome 4 at 55,016,988 bp (GRCm38)
  • A to G, chromosome 4 at 75,947,098 bp (GRCm38)
  • A to G, chromosome 4 at 88,867,965 bp (GRCm38)
  • T to C, chromosome 4 at 112,021,312 bp (GRCm38)
  • T to C, chromosome 4 at 116,820,620 bp (GRCm38)
  • T to C, chromosome 4 at 129,432,724 bp (GRCm38)
  • T to A, chromosome 4 at 148,538,319 bp (GRCm38)
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp (GRCm38)
  • G to T, chromosome 5 at 134,946,320 bp (GRCm38)
  • T to C, chromosome 6 at 34,394,092 bp (GRCm38)
  • T to C, chromosome 6 at 38,409,451 bp (GRCm38)
  • T to A, chromosome 6 at 40,572,162 bp (GRCm38)
  • A to T, chromosome 6 at 118,527,764 bp (GRCm38)
  • A to G, chromosome 6 at 125,120,725 bp (GRCm38)
  • G to T, chromosome 7 at 19,535,733 bp (GRCm38)
  • G to A, chromosome 7 at 28,174,627 bp (GRCm38)
  • G to T, chromosome 7 at 75,120,024 bp (GRCm38)
  • C to T, chromosome 7 at 78,919,857 bp (GRCm38)
  • A to G, chromosome 7 at 97,957,867 bp (GRCm38)
  • A to T, chromosome 7 at 103,211,949 bp (GRCm38)
  • C to T, chromosome 7 at 112,089,594 bp (GRCm38)
  • A to G, chromosome 7 at 131,250,489 bp (GRCm38)
  • G to A, chromosome 7 at 132,983,737 bp (GRCm38)
  • CT to C, chromosome 8 at 104,182,032 bp (GRCm38)
  • A to G, chromosome 9 at 59,524,716 bp (GRCm38)
  • C to A, chromosome 9 at 107,515,490 bp (GRCm38)
  • C to T, chromosome 10 at 5,132,021 bp (GRCm38)
  • G to A, chromosome 10 at 76,581,319 bp (GRCm38)
  • A to T, chromosome 10 at 84,925,583 bp (GRCm38)
  • A to G, chromosome 10 at 111,977,121 bp (GRCm38)
  • T to A, chromosome 10 at 128,794,654 bp (GRCm38)
  • C to T, chromosome 10 at 128,957,674 bp (GRCm38)
  • T to A, chromosome 11 at 16,875,067 bp (GRCm38)
  • T to C, chromosome 11 at 29,194,598 bp (GRCm38)
  • T to A, chromosome 11 at 60,487,417 bp (GRCm38)
  • C to A, chromosome 11 at 62,862,696 bp (GRCm38)
  • T to A, chromosome 11 at 69,436,164 bp (GRCm38)
  • C to T, chromosome 11 at 84,994,543 bp (GRCm38)
  • T to A, chromosome 12 at 31,287,984 bp (GRCm38)
  • A to T, chromosome 13 at 6,567,358 bp (GRCm38)
  • A to T, chromosome 13 at 17,993,185 bp (GRCm38)
  • A to G, chromosome 13 at 20,572,403 bp (GRCm38)
  • A to T, chromosome 13 at 24,911,690 bp (GRCm38)
  • T to A, chromosome 15 at 63,866,814 bp (GRCm38)
  • A to G, chromosome 15 at 99,692,524 bp (GRCm38)
  • T to A, chromosome 15 at 101,738,296 bp (GRCm38)
  • A to G, chromosome 16 at 23,889,737 bp (GRCm38)
  • T to C, chromosome 16 at 45,593,485 bp (GRCm38)
  • T to A, chromosome 17 at 8,323,307 bp (GRCm38)
  • T to C, chromosome 17 at 15,373,448 bp (GRCm38)
  • T to A, chromosome 17 at 18,823,775 bp (GRCm38)
  • A to C, chromosome 17 at 26,216,251 bp (GRCm38)
  • A to G, chromosome 17 at 32,396,467 bp (GRCm38)
  • T to C, chromosome 18 at 37,687,507 bp (GRCm38)
  • A to G, chromosome 19 at 45,045,583 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9417 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069221-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.