Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9418Btlr/Mmmh
Stock Number:
069222-MU
Citation ID:
RRID:MMRRC_069222-MU
Other Names:
R9418 (G1)
Major Collection:

Strain Information

Tgfb1
Name: transforming growth factor, beta 1
Synonyms: TGF-beta 1, Tgfb-1, Tgfb, TGFbeta1, TGF-beta1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21803
Homologene: 540
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Ubc
Name: ubiquitin C
Synonyms: 2700054O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22190
Homologene: 128418
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Kcnj1
Name: potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms: ROMK-2, ROMK, Kir1.1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56379
VEGA: 9
HGNC: HGNC:6255
Homologene: 56764
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Drosha
Name: drosha, ribonuclease type III
Synonyms: 1110013A17Rik, Etohi2, Rnasen
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14000
Homologene: 8293
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Dhrs7b
Name: dehydrogenase/reductase 7B
Synonyms: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216820
Homologene: 41044
Dcaf4
Name: DDB1 and CUL4 associated factor 4
Synonyms: 1110018E21Rik, Wdr21
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73828
VEGA: 12
Homologene: 9210
Hexa
Name: hexosaminidase A
Synonyms: Hex-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15211
VEGA: 9
HGNC: HGNC:4878
Homologene: 20146
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Il2ra
Name: interleukin 2 receptor, alpha chain
Synonyms: IL-2R alpha chain, CD25, Ly-43, Il2r
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16184
HGNC: HGNC:6008
Homologene: 360
Pcdh20
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Rab23
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19335
Homologene: 7503
Xxylt1
Name: xyloside xylosyltransferase 1
Synonyms: AI480653
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268880
Homologene: 17610
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Btbd16
Name: BTB domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330660
Homologene: 77327
Ciita
Name: class II transactivator
Synonyms: C2ta, Gm9475
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12265
VEGA: 16
HGNC: HGNC:7067
Homologene: 207
Adgrf5
Name: adhesion G protein-coupled receptor F5
Synonyms: 8430401C09Rik, Gpr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224792
VEGA: 17
Homologene: 9065
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213435
Homologene: 35278
Tm4sf5
Name: transmembrane 4 superfamily member 5
Synonyms: 2010003F10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75604
Homologene: 2947
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Cyp2b13
Name: cytochrome P450, family 2, subfamily b, polypeptide 13
Synonyms: phenobarbital inducible, type c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13089
HGNC: HGNC:2615
Homologene: 74933
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin, B230334C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Uroc1
Name: urocanase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243537
Homologene: 76629
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
Fbxo47
Name: F-box protein 47
Synonyms: LOC380724, 2900052P03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72973
Homologene: 47677
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Ush1c
Name: USH1 protein network component harmonin
Synonyms: 2010016F01Rik, harmonin, Usher syndrome 1C
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72088
Homologene: 77476
Kcnj2
Name: potassium inwardly-rectifying channel, subfamily J, member 2
Synonyms: IRK1, Kir2.1, Kcnf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16518
HGNC: HGNC:6263
Homologene: 20249
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Krt26
Name: keratin 26
Synonyms: 4732407F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320864
Homologene: 37118
Tmcc3
Name: transmembrane and coiled coil domains 3
Synonyms: C630016B22Rik, LOC380656, A230066D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319880
Homologene: 10792
Zfp467
Name: zinc finger protein 467
Synonyms: MNCb-3350, EZI, 1190001I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68910
Homologene: 10758
A430033K04Rik
Name: RIKEN cDNA A430033K04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243308
Homologene: 65621
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Slc22a19
Name: solute carrier family 22 (organic anion transporter), member 19
Synonyms: Oat5, D630043A20Rik, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207151
Homologene: 133125
Or2v2
Name: olfactory receptor family 2 subfamily V member 2
Synonyms: GA_x6K02T2QP88-6321048-6321995, MOR276-2, Olfr1396
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258334
Homologene: 28537
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Hectd2
Name: HECT domain E3 ubiquitin protein ligase 2
Synonyms: A630025O09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226098
Homologene: 6280
Fem1al
Name: fem-1 homolog A like
Synonyms: 4931440F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216622
Spsb2
Name: splA/ryanodine receptor domain and SOCS box containing 2
Synonyms: SSB2, Grcc9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14794
Homologene: 8404
Kcne3
Name: potassium voltage-gated channel, Isk-related subfamily, gene 3
Synonyms: MiRP2, 2210017H05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57442
HGNC: HGNC:6243
Homologene: 3994
Gpr171
Name: G protein-coupled receptor 171
Synonyms: F730001G15Rik, H963
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229323
Homologene: 36330
Leng9
Name: leukocyte receptor cluster (LRC) member 9
Synonyms: 9530024C23Rik, F630035L11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243813
Homologene: 18466
Pramel39-ps
Name: PRAME like 39, pseudogene
Synonyms: Gm16522, A430089I19Rik, Pramel39
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 331195
Homologene: 77633
Or13c7c
Name: olfactory receptor family 13 subfamily C member 7C
Synonyms: OR37C, mOR37c, Olfr37c, MOR262-12, GA_x6K02T2N78B-16110014-16110970, Olfr157
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100040268
Homologene: 133619
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 33,738,343 bp (GRCm38)
  • A to C, chromosome 1 at 93,159,988 bp (GRCm38)
  • T to C, chromosome 2 at 11,684,392 bp (GRCm38)
  • T to C, chromosome 2 at 14,229,547 bp (GRCm38)
  • G to A, chromosome 2 at 62,554,837 bp (GRCm38)
  • A to T, chromosome 2 at 77,041,422 bp (GRCm38)
  • C to A, chromosome 2 at 112,344,210 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • C to T, chromosome 2 at 144,513,488 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • T to C, chromosome 3 at 59,097,578 bp (GRCm38)
  • A to T, chromosome 3 at 158,202,386 bp (GRCm38)
  • T to C, chromosome 4 at 35,709,035 bp (GRCm38)
  • C to T, chromosome 4 at 43,835,879 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to C, chromosome 5 at 108,155,803 bp (GRCm38)
  • T to C, chromosome 5 at 125,387,402 bp (GRCm38)
  • G to A, chromosome 5 at 138,647,055 bp (GRCm38)
  • A to T, chromosome 6 at 48,439,056 bp (GRCm38)
  • G to T, chromosome 6 at 90,336,898 bp (GRCm38)
  • T to A, chromosome 6 at 122,040,741 bp (GRCm38)
  • C to A, chromosome 6 at 124,809,319 bp (GRCm38)
  • T to C, chromosome 7 at 4,148,355 bp (GRCm38)
  • A to T, chromosome 7 at 24,628,929 bp (GRCm38)
  • A to G, chromosome 7 at 25,692,527 bp (GRCm38)
  • A to T, chromosome 7 at 26,061,685 bp (GRCm38)
  • A to T, chromosome 7 at 46,222,868 bp (GRCm38)
  • A to T, chromosome 7 at 46,288,600 bp (GRCm38)
  • A to G, chromosome 7 at 100,184,178 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • C to A, chromosome 8 at 85,364,815 bp (GRCm38)
  • G to A, chromosome 9 at 32,396,907 bp (GRCm38)
  • A to G, chromosome 9 at 59,557,309 bp (GRCm38)
  • T to C, chromosome 10 at 94,579,225 bp (GRCm38)
  • C to T, chromosome 11 at 29,824,632 bp (GRCm38)
  • G to T, chromosome 11 at 49,113,657 bp (GRCm38)
  • A to T, chromosome 11 at 60,855,768 bp (GRCm38)
  • T to A, chromosome 11 at 70,510,308 bp (GRCm38)
  • T to A, chromosome 11 at 97,856,241 bp (GRCm38)
  • C to T, chromosome 11 at 99,337,915 bp (GRCm38)
  • A to T, chromosome 11 at 111,072,531 bp (GRCm38)
  • A to T, chromosome 12 at 83,539,832 bp (GRCm38)
  • G to T, chromosome 12 at 113,131,367 bp (GRCm38)
  • A to G, chromosome 13 at 92,438,724 bp (GRCm38)
  • T to C, chromosome 13 at 93,089,701 bp (GRCm38)
  • C to T, chromosome 14 at 88,468,019 bp (GRCm38)
  • T to C, chromosome 15 at 12,885,081 bp (GRCm38)
  • A to G, chromosome 15 at 103,525,037 bp (GRCm38)
  • G to T, chromosome 16 at 10,501,901 bp (GRCm38)
  • A to G, chromosome 16 at 18,951,275 bp (GRCm38)
  • A to T, chromosome 16 at 31,007,806 bp (GRCm38)
  • G to A, chromosome 17 at 43,426,973 bp (GRCm38)
  • A to G, chromosome 18 at 10,812,064 bp (GRCm38)
  • A to T, chromosome 19 at 7,682,845 bp (GRCm38)
  • A to G, chromosome 19 at 24,350,217 bp (GRCm38)
  • T to A, chromosome 19 at 36,612,174 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9418 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069222-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.