Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9418Btlr/Mmmh
Stock Number:
069222-MU
Citation ID:
RRID:MMRRC_069222-MU
Other Names:
R9418 (G1)
Major Collection:

Strain Information

Tgfb1
Name: transforming growth factor, beta 1
Synonyms: TGF-beta 1, Tgfb-1, Tgfb, TGFbeta1, TGF-beta1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21803
Homologene: 540
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Ubc
Name: ubiquitin C
Synonyms: 2700054O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22190
Homologene: 128418
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
Hira
Name: histone cell cycle regulator
Synonyms: Tuple1, D16Ertd95e, Gm15797
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15260
HGNC: HGNC:4916
Homologene: 48172
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 33,738,343 bp (GRCm38)
  • A to C, chromosome 1 at 93,159,988 bp (GRCm38)
  • T to C, chromosome 2 at 11,684,392 bp (GRCm38)
  • T to C, chromosome 2 at 14,229,547 bp (GRCm38)
  • G to A, chromosome 2 at 62,554,837 bp (GRCm38)
  • A to T, chromosome 2 at 77,041,422 bp (GRCm38)
  • C to A, chromosome 2 at 112,344,210 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • C to T, chromosome 2 at 144,513,488 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • T to C, chromosome 3 at 59,097,578 bp (GRCm38)
  • A to T, chromosome 3 at 158,202,386 bp (GRCm38)
  • T to C, chromosome 4 at 35,709,035 bp (GRCm38)
  • C to T, chromosome 4 at 43,835,879 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to C, chromosome 5 at 108,155,803 bp (GRCm38)
  • T to C, chromosome 5 at 125,387,402 bp (GRCm38)
  • G to A, chromosome 5 at 138,647,055 bp (GRCm38)
  • A to T, chromosome 6 at 48,439,056 bp (GRCm38)
  • G to T, chromosome 6 at 90,336,898 bp (GRCm38)
  • T to A, chromosome 6 at 122,040,741 bp (GRCm38)
  • C to A, chromosome 6 at 124,809,319 bp (GRCm38)
  • T to C, chromosome 7 at 4,148,355 bp (GRCm38)
  • A to T, chromosome 7 at 24,628,929 bp (GRCm38)
  • A to G, chromosome 7 at 25,692,527 bp (GRCm38)
  • A to T, chromosome 7 at 26,061,685 bp (GRCm38)
  • A to T, chromosome 7 at 46,222,868 bp (GRCm38)
  • A to T, chromosome 7 at 46,288,600 bp (GRCm38)
  • A to G, chromosome 7 at 100,184,178 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • C to A, chromosome 8 at 85,364,815 bp (GRCm38)
  • G to A, chromosome 9 at 32,396,907 bp (GRCm38)
  • A to G, chromosome 9 at 59,557,309 bp (GRCm38)
  • T to C, chromosome 10 at 94,579,225 bp (GRCm38)
  • C to T, chromosome 11 at 29,824,632 bp (GRCm38)
  • G to T, chromosome 11 at 49,113,657 bp (GRCm38)
  • A to T, chromosome 11 at 60,855,768 bp (GRCm38)
  • T to A, chromosome 11 at 70,510,308 bp (GRCm38)
  • T to A, chromosome 11 at 97,856,241 bp (GRCm38)
  • C to T, chromosome 11 at 99,337,915 bp (GRCm38)
  • A to T, chromosome 11 at 111,072,531 bp (GRCm38)
  • A to T, chromosome 12 at 83,539,832 bp (GRCm38)
  • G to T, chromosome 12 at 113,131,367 bp (GRCm38)
  • A to G, chromosome 13 at 92,438,724 bp (GRCm38)
  • T to C, chromosome 13 at 93,089,701 bp (GRCm38)
  • C to T, chromosome 14 at 88,468,019 bp (GRCm38)
  • T to C, chromosome 15 at 12,885,081 bp (GRCm38)
  • A to G, chromosome 15 at 103,525,037 bp (GRCm38)
  • G to T, chromosome 16 at 10,501,901 bp (GRCm38)
  • A to G, chromosome 16 at 18,951,275 bp (GRCm38)
  • A to T, chromosome 16 at 31,007,806 bp (GRCm38)
  • G to A, chromosome 17 at 43,426,973 bp (GRCm38)
  • A to G, chromosome 18 at 10,812,064 bp (GRCm38)
  • A to T, chromosome 19 at 7,682,845 bp (GRCm38)
  • A to G, chromosome 19 at 24,350,217 bp (GRCm38)
  • T to A, chromosome 19 at 36,612,174 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9418 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069222-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.