Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9421Btlr/Mmmh
Stock Number:
069225-MU
Citation ID:
RRID:MMRRC_069225-MU
Other Names:
R9421 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: mCDC47, Mcmd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Gpr151
Name: G protein-coupled receptor 151
Synonyms: C130082O03Rik, GalRL, PGR7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240239
VEGA: 18
Homologene: 18754
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 80,523,792 bp (GRCm38)
  • G to T, chromosome 1 at 106,023,257 bp (GRCm38)
  • A to T, chromosome 1 at 143,646,626 bp (GRCm38)
  • A to G, chromosome 2 at 49,942,540 bp (GRCm38)
  • T to C, chromosome 2 at 70,679,523 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to A, chromosome 3 at 90,047,801 bp (GRCm38)
  • C to T, chromosome 3 at 127,673,420 bp (GRCm38)
  • A to T, chromosome 4 at 19,536,561 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • T to A, chromosome 4 at 120,716,671 bp (GRCm38)
  • T to C, chromosome 5 at 36,820,927 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to A, chromosome 5 at 95,959,930 bp (GRCm38)
  • A to G, chromosome 5 at 137,855,034 bp (GRCm38)
  • T to C, chromosome 5 at 138,167,215 bp (GRCm38)
  • A to T, chromosome 5 at 140,883,707 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 39,152,829 bp (GRCm38)
  • T to C, chromosome 7 at 3,158,245 bp (GRCm38)
  • G to A, chromosome 7 at 24,303,553 bp (GRCm38)
  • A to G, chromosome 7 at 28,176,014 bp (GRCm38)
  • GC to GCGGCGGCGAC, chromosome 7 at 97,579,934 bp (GRCm38)
  • T to A, chromosome 7 at 102,928,504 bp (GRCm38)
  • T to C, chromosome 8 at 3,632,264 bp (GRCm38)
  • C to T, chromosome 8 at 22,908,306 bp (GRCm38)
  • G to A, chromosome 8 at 77,665,052 bp (GRCm38)
  • T to C, chromosome 9 at 108,499,593 bp (GRCm38)
  • A to G, chromosome 10 at 75,657,824 bp (GRCm38)
  • G to A, chromosome 10 at 81,594,034 bp (GRCm38)
  • G to T, chromosome 11 at 49,564,374 bp (GRCm38)
  • T to A, chromosome 11 at 58,286,625 bp (GRCm38)
  • T to A, chromosome 11 at 73,787,101 bp (GRCm38)
  • A to C, chromosome 11 at 74,083,505 bp (GRCm38)
  • C to G, chromosome 11 at 114,696,807 bp (GRCm38)
  • A to T, chromosome 15 at 12,375,028 bp (GRCm38)
  • C to A, chromosome 16 at 35,698,002 bp (GRCm38)
  • A to T, chromosome 16 at 87,418,487 bp (GRCm38)
  • A to T, chromosome 17 at 21,819,355 bp (GRCm38)
  • A to T, chromosome 17 at 27,876,686 bp (GRCm38)
  • T to C, chromosome 18 at 42,579,155 bp (GRCm38)
  • G to A, chromosome 18 at 65,624,237 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9421 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069225-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.