Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9421Btlr/Mmmh
Stock Number:
069225-MU
Citation ID:
RRID:MMRRC_069225-MU
Other Names:
R9421 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Mcm7
Name: minichromosome maintenance complex component 7
Synonyms: mCDC47, Mcmd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17220
HGNC: HGNC:6950
Homologene: 4323
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Gpr151
Name: G protein-coupled receptor 151
Synonyms: C130082O03Rik, GalRL, PGR7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240239
VEGA: 18
Homologene: 18754
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Bltp3a
Name: bridge-like lipid transfer protein family member 3A
Synonyms: 1110020K19Rik, F830021D11Rik, Uhrf1bp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224648
Homologene: 9816
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: RCC4, Dirc2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224132
Homologene: 13137
B3galt2
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26878
HGNC: HGNC:917
Homologene: 74512
Fbl
Name: fibrillarin
Synonyms: RNU3IP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14113
HGNC: HGNC:3599
Homologene: 1099
Gorasp2
Name: golgi reassembly stacking protein 2
Synonyms: GRASP55, 5730520M13Rik, 9430094F20Rik, GOLPH2, GRS2, p59, ENSMUSG00000075299
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70231
Homologene: 9180
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227449
Homologene: 9808
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cxcl13
Name: C-X-C motif chemokine ligand 13
Synonyms: BCA-1, BLC, Scyb13, ANGIE2, 4631412M08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55985
Homologene: 48431
Stxbp2
Name: syntaxin binding protein 2
Synonyms: Munc-18b, Munc-18-2, C79054, Sxtp2, Munc18b, muSec1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20911
Homologene: 55530
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Kdm7a
Name: lysine (K)-specific demethylase 7A
Synonyms: A630082K20Rik, ENSMUSG00000073143, Kdm7a, Jhdm1d
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 338523
Homologene: 25281
Kcnq4
Name: potassium voltage-gated channel, subfamily Q, member 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60613
HGNC: HGNC:6298
Homologene: 78107
Ednra
Name: endothelin receptor type A
Synonyms: ETa, ET-AR, Gpcr10, AEA001, Mhdaaea1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13617
HGNC: HGNC:3179
Homologene: 1478
AU018091
Name: expressed sequence AU018091
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245128
Homologene: 106376
Ttyh2
Name: tweety family member 2
Synonyms: 1110001A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 117160
Homologene: 41882
Or1e30
Name: olfactory receptor family 1 subfamily E member 30
Synonyms: GA_x6K02T2P1NL-3938806-3939741, MOR135-26, Olfr390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258344
Homologene: 115483
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Zfp820
Name: zinc finger protein 820
Synonyms: 2610036F08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75424
VEGA: 17
Or2y10
Name: olfactory receptor family 2 subfamily Y member 10
Synonyms: GA_x6K02T2QP88-5871967-5871032, MOR256-66_i, Olfr1380
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 404336
Homologene: 72463
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Pilrb1
Name: paired immunoglobin-like type 2 receptor beta 1
Synonyms: Fdact, Pilrb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170741
Homologene: 114502
Tle6
Name: transducin-like enhancer of split 6
Synonyms: Grg6, 1810057E06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114606
Homologene: 11701
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17160
Homologene: 7411
Or51h5
Name: olfactory receptor family 51 subfamily H member 5
Synonyms: GA_x6K02T2PBJ9-5638785-5639741, MOR10-2, Olfr572
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259093
Homologene: 131142
4930438A08Rik
Name: RIKEN cDNA 4930438A08 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73988
Homologene: 104884
Lypd6b
Name: LY6/PLAUR domain containing 6B
Synonyms: 2310010M24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71897
Homologene: 12419
Pramel39-ps
Name: PRAME like 39, pseudogene
Synonyms: Gm16522, A430089I19Rik, Pramel39
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 331195
Homologene: 77633
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 80,523,792 bp (GRCm38)
  • G to T, chromosome 1 at 106,023,257 bp (GRCm38)
  • A to T, chromosome 1 at 143,646,626 bp (GRCm38)
  • A to G, chromosome 2 at 49,942,540 bp (GRCm38)
  • T to C, chromosome 2 at 70,679,523 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to A, chromosome 3 at 90,047,801 bp (GRCm38)
  • C to T, chromosome 3 at 127,673,420 bp (GRCm38)
  • A to T, chromosome 4 at 19,536,561 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • T to A, chromosome 4 at 120,716,671 bp (GRCm38)
  • T to C, chromosome 5 at 36,820,927 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • T to A, chromosome 5 at 95,959,930 bp (GRCm38)
  • A to G, chromosome 5 at 137,855,034 bp (GRCm38)
  • T to C, chromosome 5 at 138,167,215 bp (GRCm38)
  • A to T, chromosome 5 at 140,883,707 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 39,152,829 bp (GRCm38)
  • T to C, chromosome 7 at 3,158,245 bp (GRCm38)
  • G to A, chromosome 7 at 24,303,553 bp (GRCm38)
  • A to G, chromosome 7 at 28,176,014 bp (GRCm38)
  • GC to GCGGCGGCGAC, chromosome 7 at 97,579,934 bp (GRCm38)
  • T to A, chromosome 7 at 102,928,504 bp (GRCm38)
  • T to C, chromosome 8 at 3,632,264 bp (GRCm38)
  • C to T, chromosome 8 at 22,908,306 bp (GRCm38)
  • G to A, chromosome 8 at 77,665,052 bp (GRCm38)
  • T to C, chromosome 9 at 108,499,593 bp (GRCm38)
  • A to G, chromosome 10 at 75,657,824 bp (GRCm38)
  • G to A, chromosome 10 at 81,594,034 bp (GRCm38)
  • G to T, chromosome 11 at 49,564,374 bp (GRCm38)
  • T to A, chromosome 11 at 58,286,625 bp (GRCm38)
  • T to A, chromosome 11 at 73,787,101 bp (GRCm38)
  • A to C, chromosome 11 at 74,083,505 bp (GRCm38)
  • C to G, chromosome 11 at 114,696,807 bp (GRCm38)
  • A to T, chromosome 15 at 12,375,028 bp (GRCm38)
  • C to A, chromosome 16 at 35,698,002 bp (GRCm38)
  • A to T, chromosome 16 at 87,418,487 bp (GRCm38)
  • A to T, chromosome 17 at 21,819,355 bp (GRCm38)
  • A to T, chromosome 17 at 27,876,686 bp (GRCm38)
  • T to C, chromosome 18 at 42,579,155 bp (GRCm38)
  • G to A, chromosome 18 at 65,624,237 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9421 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069225-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.