Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9423Btlr/Mmmh
Stock Number:
069227-MU
Citation ID:
RRID:MMRRC_069227-MU
Other Names:
R9423 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: 5-HT2A receptor, Htr-2, Htr2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Sirt1
Name: sirtuin 1
Synonyms: Sir2, Sir2alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 93759
Homologene: 56556
Tacr3
Name: tachykinin receptor 3
Synonyms: neuromedin K receptor, Tac3r, Nk3r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21338
Homologene: 824
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 107,538,449 bp (GRCm38)
  • T to C, chromosome 1 at 134,587,967 bp (GRCm38)
  • T to C, chromosome 1 at 151,450,066 bp (GRCm38)
  • T to A, chromosome 1 at 172,179,957 bp (GRCm38)
  • T to C, chromosome 2 at 11,482,465 bp (GRCm38)
  • C to A, chromosome 2 at 14,141,753 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • C to T, chromosome 2 at 35,709,954 bp (GRCm38)
  • AAGT to AAGTAGT, chromosome 2 at 98,663,803 bp (GRCm38)
  • A to T, chromosome 2 at 112,072,463 bp (GRCm38)
  • A to T, chromosome 2 at 130,038,607 bp (GRCm38)
  • G to T, chromosome 2 at 146,143,235 bp (GRCm38)
  • T to A, chromosome 3 at 89,184,700 bp (GRCm38)
  • C to T, chromosome 3 at 107,671,160 bp (GRCm38)
  • A to G, chromosome 3 at 134,932,282 bp (GRCm38)
  • T to C, chromosome 4 at 106,431,670 bp (GRCm38)
  • C to A, chromosome 4 at 154,986,592 bp (GRCm38)
  • G to A, chromosome 5 at 7,976,720 bp (GRCm38)
  • A to C, chromosome 5 at 124,133,406 bp (GRCm38)
  • A to G, chromosome 5 at 144,218,578 bp (GRCm38)
  • T to C, chromosome 6 at 7,999,601 bp (GRCm38)
  • T to A, chromosome 7 at 12,615,514 bp (GRCm38)
  • A to G, chromosome 7 at 28,414,208 bp (GRCm38)
  • G to GACGGCGGCT, chromosome 7 at 97,579,909 bp (GRCm38)
  • A to T, chromosome 7 at 104,429,203 bp (GRCm38)
  • A to G, chromosome 7 at 142,385,475 bp (GRCm38)
  • A to G, chromosome 8 at 109,623,680 bp (GRCm38)
  • A to G, chromosome 8 at 123,962,080 bp (GRCm38)
  • G to T, chromosome 9 at 39,184,542 bp (GRCm38)
  • T to C, chromosome 10 at 11,205,263 bp (GRCm38)
  • T to C, chromosome 10 at 40,225,340 bp (GRCm38)
  • T to C, chromosome 10 at 60,312,608 bp (GRCm38)
  • T to C, chromosome 10 at 63,322,246 bp (GRCm38)
  • C to A, chromosome 10 at 82,287,625 bp (GRCm38)
  • C to A, chromosome 10 at 89,473,826 bp (GRCm38)
  • C to T, chromosome 10 at 128,721,186 bp (GRCm38)
  • T to C, chromosome 11 at 9,290,395 bp (GRCm38)
  • A to G, chromosome 11 at 120,010,694 bp (GRCm38)
  • T to G, chromosome 12 at 80,757,388 bp (GRCm38)
  • T to C, chromosome 13 at 19,751,825 bp (GRCm38)
  • C to T, chromosome 13 at 32,842,927 bp (GRCm38)
  • T to C, chromosome 13 at 96,410,606 bp (GRCm38)
  • T to G, chromosome 14 at 32,217,705 bp (GRCm38)
  • A to G, chromosome 14 at 47,674,861 bp (GRCm38)
  • T to A, chromosome 14 at 74,706,076 bp (GRCm38)
  • A to G, chromosome 15 at 59,355,886 bp (GRCm38)
  • T to C, chromosome 16 at 44,951,532 bp (GRCm38)
  • G to A, chromosome 17 at 75,290,117 bp (GRCm38)
  • T to C, chromosome 18 at 42,395,894 bp (GRCm38)
  • C to T, chromosome 18 at 44,405,294 bp (GRCm38)
  • G to T, chromosome 18 at 58,890,355 bp (GRCm38)
  • T to A, chromosome 18 at 76,860,605 bp (GRCm38)
  • T to C, chromosome 19 at 6,313,299 bp (GRCm38)
  • T to C, chromosome 19 at 7,420,259 bp (GRCm38)
  • T to A, chromosome 19 at 8,712,825 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9423 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069227-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.