Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9423Btlr/Mmmh
Stock Number:
069227-MU
Citation ID:
RRID:MMRRC_069227-MU
Other Names:
R9423 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: 5-HT2A receptor, Htr-2, Htr2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Sirt1
Name: sirtuin 1
Synonyms: Sir2, Sir2alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 93759
Homologene: 56556
Tacr3
Name: tachykinin receptor 3
Synonyms: neuromedin K receptor, Tac3r, Nk3r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21338
Homologene: 824
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Samd4b
Name: sterile alpha motif domain containing 4B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233033
Homologene: 35268
Dcaf8
Name: DDB1 and CUL4 associated factor 8
Synonyms: H326, D1Ucla4, D1Dau35e, Wdr42a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98193
Homologene: 56725
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26430
HGNC: HGNC:8605
Homologene: 50532
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Dcp2
Name: decapping mRNA 2
Synonyms: 2410015D23Rik, 5730537H01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70640
Homologene: 13968
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Slc3a2
Name: solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Synonyms: Mgp-2hc, Ly-m10, Ly-10, Mdu1, 4F2HC, Cd98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17254
Homologene: 1795
Rpf2
Name: ribosome production factor 2 homolog
Synonyms: 2810470K21Rik, Bxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67239
Homologene: 6404
Poc5
Name: POC5 centriolar protein
Synonyms: 1200014M14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67463
VEGA: 13
Homologene: 12141
Zfta
Name: zinc finger translocation associated
Synonyms: 2700081O15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108899
Homologene: 52179
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: DCAL, 1110034F20Rik, Ahcy-rs3, IRBIT
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229709
HGNC: HGNC:344
Homologene: 77353
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21818
Homologene: 20690
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Col28a1
Name: collagen, type XXVIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213945
Homologene: 66345
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Serpinb1a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1a
Synonyms: LEI, 1190005M04Rik, ovalbumin, ELANH2, M/NEI, MNEI, EIA
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66222
HGNC: HGNC:3311
Homologene: 133768
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Pitpnm2
Name: phosphatidylinositol transfer protein, membrane-associated 2
Synonyms: RDGBA2, NIR3, Rdgb2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19679
Homologene: 7915
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Adamts19
Name: ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms: D230034E10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240322
VEGA: 18
Homologene: 15860
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Gpr141
Name: G protein-coupled receptor 141
Synonyms: Pgr13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 353346
VEGA: 13
Homologene: 18771
Vmn2r54
Name: vomeronasal 2, receptor 54
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666085
Homologene: 104040
Abcb10
Name: ATP-binding cassette, sub-family B member 10
Synonyms: ABC-me
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56199
HGNC: HGNC:41
Homologene: 6474
Steap4
Name: STEAP family member 4
Synonyms: Tiarp, Tnfaip9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117167
Homologene: 36422
Or8g26
Name: olfactory receptor family 8 subfamily G member 26
Synonyms: GA_x6K02T2PVTD-32881408-32882343, MOR171-44, Olfr943
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258323
VEGA: 9
HGNC: HGNC:8484
Homologene: 110526
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78774
Nr1h4
Name: nuclear receptor subfamily 1, group H, member 4
Synonyms: RIP14, FXR, HRR1, Rxrip14, Fxr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20186
HGNC: HGNC:7967
Homologene: 3760
Cd200r3
Name: CD200 receptor 3
Synonyms: 4733401I18Rik, mCD200RLb, 4833409J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74603
Entrep3
Name: endosomal transmembrane epsin interactor 3
Synonyms: 1110013L07Rik, Fam189b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68521
HGNC: HGNC:1233
Homologene: 4805
Ccdc177
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380768
VEGA: 12
Homologene: 128326
Pfkfb3
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Synonyms: E330010H22Rik, uPFK-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170768
HGNC: HGNC:8874
Homologene: 88708
Or4f60
Name: olfactory receptor family 4 subfamily F member 60
Synonyms: GA_x6K02T2Q125-73119859-73118924, MOR245-23, Olfr1313
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258257
Homologene: 106834
Pou4f3
Name: POU domain, class 4, transcription factor 3
Synonyms: Brn-3.1, Brn3.1, Brn3c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18998
HGNC: HGNC:9220
Homologene: 2023
Ctsd
Name: cathepsin D
Synonyms: CatD, CD
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13033
HGNC: HGNC:2529
Homologene: 55616
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 107,538,449 bp (GRCm38)
  • T to C, chromosome 1 at 134,587,967 bp (GRCm38)
  • T to C, chromosome 1 at 151,450,066 bp (GRCm38)
  • T to A, chromosome 1 at 172,179,957 bp (GRCm38)
  • T to C, chromosome 2 at 11,482,465 bp (GRCm38)
  • C to A, chromosome 2 at 14,141,753 bp (GRCm38)
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp (GRCm38)
  • C to T, chromosome 2 at 35,709,954 bp (GRCm38)
  • AAGT to AAGTAGT, chromosome 2 at 98,663,803 bp (GRCm38)
  • A to T, chromosome 2 at 112,072,463 bp (GRCm38)
  • A to T, chromosome 2 at 130,038,607 bp (GRCm38)
  • G to T, chromosome 2 at 146,143,235 bp (GRCm38)
  • T to A, chromosome 3 at 89,184,700 bp (GRCm38)
  • C to T, chromosome 3 at 107,671,160 bp (GRCm38)
  • A to G, chromosome 3 at 134,932,282 bp (GRCm38)
  • T to C, chromosome 4 at 106,431,670 bp (GRCm38)
  • C to A, chromosome 4 at 154,986,592 bp (GRCm38)
  • G to A, chromosome 5 at 7,976,720 bp (GRCm38)
  • A to C, chromosome 5 at 124,133,406 bp (GRCm38)
  • A to G, chromosome 5 at 144,218,578 bp (GRCm38)
  • T to C, chromosome 6 at 7,999,601 bp (GRCm38)
  • T to A, chromosome 7 at 12,615,514 bp (GRCm38)
  • A to G, chromosome 7 at 28,414,208 bp (GRCm38)
  • G to GACGGCGGCT, chromosome 7 at 97,579,909 bp (GRCm38)
  • A to T, chromosome 7 at 104,429,203 bp (GRCm38)
  • A to G, chromosome 7 at 142,385,475 bp (GRCm38)
  • A to G, chromosome 8 at 109,623,680 bp (GRCm38)
  • A to G, chromosome 8 at 123,962,080 bp (GRCm38)
  • G to T, chromosome 9 at 39,184,542 bp (GRCm38)
  • T to C, chromosome 10 at 11,205,263 bp (GRCm38)
  • T to C, chromosome 10 at 40,225,340 bp (GRCm38)
  • T to C, chromosome 10 at 60,312,608 bp (GRCm38)
  • T to C, chromosome 10 at 63,322,246 bp (GRCm38)
  • C to A, chromosome 10 at 82,287,625 bp (GRCm38)
  • C to A, chromosome 10 at 89,473,826 bp (GRCm38)
  • C to T, chromosome 10 at 128,721,186 bp (GRCm38)
  • T to C, chromosome 11 at 9,290,395 bp (GRCm38)
  • A to G, chromosome 11 at 120,010,694 bp (GRCm38)
  • T to G, chromosome 12 at 80,757,388 bp (GRCm38)
  • T to C, chromosome 13 at 19,751,825 bp (GRCm38)
  • C to T, chromosome 13 at 32,842,927 bp (GRCm38)
  • T to C, chromosome 13 at 96,410,606 bp (GRCm38)
  • T to G, chromosome 14 at 32,217,705 bp (GRCm38)
  • A to G, chromosome 14 at 47,674,861 bp (GRCm38)
  • T to A, chromosome 14 at 74,706,076 bp (GRCm38)
  • A to G, chromosome 15 at 59,355,886 bp (GRCm38)
  • T to C, chromosome 16 at 44,951,532 bp (GRCm38)
  • G to A, chromosome 17 at 75,290,117 bp (GRCm38)
  • T to C, chromosome 18 at 42,395,894 bp (GRCm38)
  • C to T, chromosome 18 at 44,405,294 bp (GRCm38)
  • G to T, chromosome 18 at 58,890,355 bp (GRCm38)
  • T to A, chromosome 18 at 76,860,605 bp (GRCm38)
  • T to C, chromosome 19 at 6,313,299 bp (GRCm38)
  • T to C, chromosome 19 at 7,420,259 bp (GRCm38)
  • T to A, chromosome 19 at 8,712,825 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9423 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069227-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.