Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9426Btlr/Mmmh
Stock Number:
069230-MU
Citation ID:
RRID:MMRRC_069230-MU
Other Names:
R9426 (G1)
Major Collection:

Strain Information

Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 21,402,894 bp (GRCm38)
  • A to T, chromosome 1 at 30,831,544 bp (GRCm38)
  • C to G, chromosome 1 at 55,067,560 bp (GRCm38)
  • T to C, chromosome 1 at 128,236,475 bp (GRCm38)
  • T to A, chromosome 1 at 177,743,268 bp (GRCm38)
  • T to A, chromosome 2 at 5,054,674 bp (GRCm38)
  • T to C, chromosome 2 at 32,615,082 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • C to T, chromosome 2 at 119,069,498 bp (GRCm38)
  • T to A, chromosome 2 at 119,353,433 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to A, chromosome 2 at 134,505,635 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • G to C, chromosome 4 at 47,288,200 bp (GRCm38)
  • T to G, chromosome 4 at 82,498,292 bp (GRCm38)
  • A to T, chromosome 4 at 103,049,546 bp (GRCm38)
  • C to A, chromosome 4 at 117,066,381 bp (GRCm38)
  • T to C, chromosome 4 at 120,505,359 bp (GRCm38)
  • A to C, chromosome 4 at 154,281,843 bp (GRCm38)
  • T to A, chromosome 5 at 87,517,421 bp (GRCm38)
  • G to T, chromosome 5 at 94,303,142 bp (GRCm38)
  • C to T, chromosome 7 at 3,327,459 bp (GRCm38)
  • A to T, chromosome 7 at 28,143,856 bp (GRCm38)
  • A to T, chromosome 7 at 43,443,264 bp (GRCm38)
  • A to T, chromosome 7 at 81,024,457 bp (GRCm38)
  • A to G, chromosome 8 at 13,224,034 bp (GRCm38)
  • A to G, chromosome 8 at 104,929,588 bp (GRCm38)
  • C to T, chromosome 8 at 105,329,858 bp (GRCm38)
  • A to G, chromosome 8 at 106,874,191 bp (GRCm38)
  • T to G, chromosome 8 at 124,028,546 bp (GRCm38)
  • A to G, chromosome 9 at 30,953,425 bp (GRCm38)
  • T to A, chromosome 9 at 122,157,260 bp (GRCm38)
  • T to A, chromosome 10 at 79,859,063 bp (GRCm38)
  • A to G, chromosome 10 at 80,015,430 bp (GRCm38)
  • T to A, chromosome 10 at 82,290,776 bp (GRCm38)
  • T to C, chromosome 10 at 86,869,047 bp (GRCm38)
  • A to T, chromosome 11 at 87,889,230 bp (GRCm38)
  • T to C, chromosome 12 at 51,648,090 bp (GRCm38)
  • A to G, chromosome 12 at 59,007,104 bp (GRCm38)
  • A to G, chromosome 12 at 104,121,390 bp (GRCm38)
  • T to C, chromosome 14 at 55,513,719 bp (GRCm38)
  • A to T, chromosome 15 at 102,970,854 bp (GRCm38)
  • A to G, chromosome 16 at 22,009,741 bp (GRCm38)
  • T to C, chromosome 17 at 13,364,201 bp (GRCm38)
  • C to T, chromosome 17 at 71,365,130 bp (GRCm38)
  • C to T, chromosome 17 at 75,291,314 bp (GRCm38)
  • A to G, chromosome 19 at 47,825,798 bp (GRCm38)
  • G to A, chromosome X at 170,676,464 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9426 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069230-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.