Strain Name:
C57BL/6J-MtgxR9428Btlr/Mmmh
Stock Number:
069232-MU
Citation ID:
RRID:MMRRC_069232-MU
Other Names:
R9428 (G1)
Major Collection:

Strain Information

Arc
Name: activity regulated cytoskeletal-associated protein
Synonyms: Arc3.1, arg 3.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11838
HGNC: HGNC:648
Homologene: 9056
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, PBP, CRSP210, DRIP205, Pparbp, l11Jus15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Chgb
Name: chromogranin B
Synonyms: secretogranin I, Scg-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12653
HGNC: HGNC:1930
Homologene: 1375
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Hbr-1, Gfrp, Hbr1, TR3, Hmr, N10, NGFI-B, GFRP1, NP10, TIS1, Nur77
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: Vprbp, B930007L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Carmil, Lrrc16, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: SmcD, Mmip1, Cspg6, Bamacan
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: Ltpr7, 2310022G15Rik, LTRPC7, 5033407O22Rik, TRP-PLIK, CHAK, CHAK1, 4833414K03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Akap12
Name: A kinase anchor protein 12
Synonyms: Tsga12, SSeCKS, Srcs5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Nol9
Name: nucleolar protein 9
Synonyms: 6030462G04Rik, 4632412I24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74035
Homologene: 32589
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 4432404J10Rik, 2010005B09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66691
Homologene: 32637
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Itpr-1, opt, wblo, InsP3R type I, Pcp-1, Ip3r, IP3R1, Pcp1, P400
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Plekhg5
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269608
Homologene: 10768
Mxi1
Name: MAX interactor 1, dimerization protein
Synonyms: bHLHc11, Mad2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17859
VEGA: 19
HGNC: HGNC:7534
Homologene: 4351
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: Crpd, CRP-[a], ebnerin, hensin, MUCLIN, gp300, vomeroglandin, CRP-[b]
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Scube2
Name: signal peptide, CUB domain, EGF-like 2
Synonyms: ICRFP703N2430Q5.1, ICRFP703B1614Q5.1, Cegf1, 4932442O19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56788
Homologene: 36383
Ptprc
Name: protein tyrosine phosphatase receptor type C
Synonyms: T200, Lyt-4, Ly-5, B220, CD45
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Mphosph8
Name: M-phase phosphoprotein 8
Synonyms: 4930548G07Rik, 1500035L22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75339
Homologene: 11380
Lmo7
Name: LIM domain only 7
Synonyms: FBXO20, LOC380928
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Psmd4
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 4
Synonyms: Af1, Mcb1, angiocidin, multiubiquitin-chain-binding protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19185
HGNC: HGNC:9561
Homologene: 55691
Mtfr2
Name: mitochondrial fission regulator 2
Synonyms: 2610016C23Rik, 4933412C16Rik, Fam54a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71804
VEGA: 10
Homologene: 69441
Stimate
Name: STIM activating enhancer
Synonyms: 2310014H19Rik, Tmem110, 1810038N08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69179
Homologene: 7082
Arhgap44
Name: Rho GTPase activating protein 44
Synonyms: AU040829
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216831
Homologene: 65284
Pgap1
Name: post-GPI attachment to proteins 1
Synonyms: D230012E17Rik, oto, PGAP1, 5033403E17Rik, 9030223K07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241062
Homologene: 41605
Dlx3
Name: distal-less homeobox 3
Synonyms: Dlx-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13393
HGNC: HGNC:2916
Homologene: 74544
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4921531K01Rik, 4930511P15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Mycbpap
Name: MYCBP associated protein
Synonyms: 4932408B01Rik, AMAP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104601
Homologene: 49982
Nell1
Name: NEL-like 1
Synonyms: l7R6, B230343H07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Zc3h12a
Name: zinc finger CCCH type containing 12A
Synonyms: Mcpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230738
Homologene: 11824
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, Adgrc1, crash
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Ush2a
Name: usherin
Synonyms: Ushrn, A930037M10Rik, MUSH2A, LOC269160, A930011D15Rik, LOC381317, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, steerin 3, unc53H3, 9630020C08Rik, 4732483H20Rik, POMFIL1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Tubgcp6
Name: tubulin, gamma complex component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328580
Homologene: 32477
Vmn1r213
Name: vomeronasal 1 receptor 213
Synonyms: V1rh6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171249
Homologene: 110880
Rab44
Name: RAB44, member RAS oncogene family
Synonyms: 9830134C10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 442827
Homologene: 53300
Cblif
Name: cobalamin binding intrinsic factor
Synonyms: Gif
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14603
HGNC: HGNC:4268
Homologene: 3773
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Kcnh6
Name: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: m-erg2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192775
Homologene: 32740
Ndst2
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms: [Heparan sulfate]-glucosamine N-sulfotransferase, glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17423
VEGA: 14
HGNC: HGNC:7681
Homologene: 20803
Pex6
Name: peroxisomal biogenesis factor 6
Synonyms: D130055I09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224824
HGNC: HGNC:8859
Homologene: 47914
Espnl
Name: espin-like
Synonyms: LOC227357
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227357
Homologene: 77795
Cnih3
Name: cornichon family AMPA receptor auxiliary protein 3
Synonyms: 2900075G08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72978
Homologene: 12486
Acte1
Name: actin, epsilon 1
Synonyms: LOC244239, Gm498
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102636989
Homologene: 131918
Lipo4
Name: lipase, member O4
Synonyms: Gm6857
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 628236
Homologene: 103863
Oas2
Name: 2'-5' oligoadenylate synthetase 2
Synonyms: Oasl11, 2'-5' oligoadenylate synthetase-like 11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246728
HGNC: HGNC:8087
Homologene: 49478
Wdhd1
Name: WD repeat and HMG-box DNA binding protein 1
Synonyms: D630024B06Rik, AND-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218973
Homologene: 56019
Vmn1r215
Name: vomeronasal 1 receptor 215
Synonyms: V1ri2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171253
Homologene: 110880
Nrdc
Name: nardilysin convertase
Synonyms: NRD-C, Nrd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230598
HGNC: HGNC:7995
Homologene: 68260
Scgb1b24
Name: secretoglobin, family 1B, member 24
Synonyms: Abpa24, Gm12769
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043860
Homologene: 114479
Socs4
Name: suppressor of cytokine signaling 4
Synonyms: Socs7, A730004F22Rik, 3110032M18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67296
Homologene: 15442
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22145
Homologene: 68496
Arhgap11a
Name: Rho GTPase activating protein 11A
Synonyms: 6530401L14Rik, GAP (1-12)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228482
Homologene: 8862
Fxn
Name: frataxin
Synonyms: Frda
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14297
HGNC: HGNC:3951
Homologene: 47908
Vmn2r51
Name: vomeronasal 2, receptor 51
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042921
Homologene: 113703
Agmo
Name: alkylglycerol monooxygenase
Synonyms: A530016O06Rik, Tmem195
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319660
Homologene: 45620
Pheta1
Name: PH domain containing endocytic trafficking adaptor 1
Synonyms: Ses1, A230106M15Rik, Fam109a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231717
Homologene: 16966
Sra1
Name: steroid receptor RNA activator 1
Synonyms: Srap
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 24068
Homologene: 11906
Socs5
Name: suppressor of cytokine signaling 5
Synonyms: 1810018L08Rik, Cish5, SOCS-5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56468
VEGA: 17
Homologene: 10495
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Or8w1
Name: olfactory receptor family 8 subfamily U member 1
Synonyms: Olfr1132, GA_x6K02T2Q125-49140947-49140021, MOR177-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258833
Homologene: 121518
Ivd
Name: isovaleryl coenzyme A dehydrogenase
Synonyms: 1300016K07Rik, 6720455E18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56357
HGNC: HGNC:6186
Homologene: 1676
Mill2
Name: MHC I like leukocyte 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243864
Homologene: 88329
Vmn1r18
Name: vomeronasal 1 receptor 18
Synonyms: V1rc26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171199
Homologene: 138094
Prp2rt
Name: proteolipid protein 2, retrotransposed
Synonyms: Gm6169
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 620648
VEGA: 13
HGNC: HGNC:9087
Sgo2b
Name: shugoshin 2B
Synonyms: Sgol2b, Gm4975
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: Gm626, LOC380890, ENSMUSG00000071536, LOC268729, Frmpd2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 54,536,047 bp (GRCm38)
  • G to T, chromosome 1 at 75,216,042 bp (GRCm38)
  • A to G, chromosome 1 at 91,345,873 bp (GRCm38)
  • A to T, chromosome 1 at 130,653,357 bp (GRCm38)
  • T to A, chromosome 1 at 138,113,747 bp (GRCm38)
  • T to C, chromosome 1 at 181,353,292 bp (GRCm38)
  • A to G, chromosome 1 at 188,443,119 bp (GRCm38)
  • T to C, chromosome 2 at 21,783,161 bp (GRCm38)
  • T to A, chromosome 2 at 34,717,306 bp (GRCm38)
  • T to C, chromosome 2 at 59,771,204 bp (GRCm38)
  • T to C, chromosome 2 at 87,635,430 bp (GRCm38)
  • C to T, chromosome 2 at 113,836,934 bp (GRCm38)
  • T to A, chromosome 2 at 118,877,888 bp (GRCm38)
  • T to C, chromosome 2 at 126,829,220 bp (GRCm38)
  • C to G, chromosome 2 at 132,793,234 bp (GRCm38)
  • AC to A, chromosome 3 at 56,090,972 bp (GRCm38)
  • G to A, chromosome 3 at 95,033,456 bp (GRCm38)
  • T to A, chromosome 3 at 123,546,869 bp (GRCm38)
  • T to C, chromosome 4 at 109,000,924 bp (GRCm38)
  • T to C, chromosome 4 at 125,126,765 bp (GRCm38)
  • C to T, chromosome 4 at 133,064,462 bp (GRCm38)
  • A to T, chromosome 4 at 152,039,652 bp (GRCm38)
  • T to C, chromosome 4 at 152,108,323 bp (GRCm38)
  • G to T, chromosome 5 at 95,801,686 bp (GRCm38)
  • T to A, chromosome 5 at 120,749,511 bp (GRCm38)
  • C to T, chromosome 5 at 121,853,084 bp (GRCm38)
  • A to T, chromosome 6 at 57,390,550 bp (GRCm38)
  • T to A, chromosome 6 at 108,401,347 bp (GRCm38)
  • CGGCCAATAGAAGAAACTTTTACCTTCAAGCAGTGAGAACTGGC to CGGC, chromosome 7 at 10,099,785 bp (GRCm38)
  • A to T, chromosome 7 at 18,840,025 bp (GRCm38)
  • A to T, chromosome 7 at 33,744,068 bp (GRCm38)
  • A to T, chromosome 7 at 50,853,935 bp (GRCm38)
  • A to T, chromosome 7 at 109,829,138 bp (GRCm38)
  • A to T, chromosome 7 at 131,066,478 bp (GRCm38)
  • A to T, chromosome 7 at 138,209,761 bp (GRCm38)
  • A to C, chromosome 7 at 141,808,822 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • A to T, chromosome 8 at 63,940,033 bp (GRCm38)
  • T to A, chromosome 9 at 106,858,329 bp (GRCm38)
  • T to A, chromosome 10 at 4,353,409 bp (GRCm38)
  • T to A, chromosome 10 at 20,357,293 bp (GRCm38)
  • T to C, chromosome 10 at 52,081,965 bp (GRCm38)
  • T to A, chromosome 10 at 82,377,656 bp (GRCm38)
  • T to C, chromosome 10 at 109,769,315 bp (GRCm38)
  • A to G, chromosome 11 at 65,008,342 bp (GRCm38)
  • T to C, chromosome 11 at 94,503,169 bp (GRCm38)
  • T to C, chromosome 11 at 95,120,604 bp (GRCm38)
  • T to A, chromosome 11 at 98,189,223 bp (GRCm38)
  • T to C, chromosome 11 at 106,008,995 bp (GRCm38)
  • A to G, chromosome 12 at 37,405,331 bp (GRCm38)
  • G to A, chromosome 13 at 23,011,774 bp (GRCm38)
  • A to T, chromosome 13 at 23,076,579 bp (GRCm38)
  • A to T, chromosome 13 at 24,111,851 bp (GRCm38)
  • A to G, chromosome 13 at 97,099,216 bp (GRCm38)
  • A to T, chromosome 14 at 20,725,402 bp (GRCm38)
  • T to C, chromosome 14 at 30,872,688 bp (GRCm38)
  • T to C, chromosome 14 at 33,550,053 bp (GRCm38)
  • A to C, chromosome 14 at 47,251,970 bp (GRCm38)
  • G to A, chromosome 14 at 47,290,577 bp (GRCm38)
  • A to G, chromosome 14 at 56,696,657 bp (GRCm38)
  • A to G, chromosome 14 at 101,917,640 bp (GRCm38)
  • A to G, chromosome 15 at 74,671,214 bp (GRCm38)
  • A to G, chromosome 15 at 76,183,521 bp (GRCm38)
  • A to T, chromosome 15 at 85,931,348 bp (GRCm38)
  • G to A, chromosome 15 at 89,100,897 bp (GRCm38)
  • T to C, chromosome 15 at 101,270,364 bp (GRCm38)
  • A to T, chromosome 17 at 29,139,341 bp (GRCm38)
  • G to A, chromosome 17 at 34,730,911 bp (GRCm38)
  • A to G, chromosome 17 at 46,712,065 bp (GRCm38)
  • G to T, chromosome 17 at 84,566,413 bp (GRCm38)
  • T to A, chromosome 17 at 87,133,639 bp (GRCm38)
  • A to G, chromosome 18 at 36,677,246 bp (GRCm38)
  • A to G, chromosome 19 at 11,757,738 bp (GRCm38)
  • A to T, chromosome 19 at 24,272,423 bp (GRCm38)
  • C to T, chromosome 19 at 33,517,674 bp (GRCm38)
  • C to A, chromosome 19 at 53,310,782 bp (GRCm38)
  • G to C, chromosome 19 at 53,628,719 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9428 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069232-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.