Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9428Btlr/Mmmh
Stock Number:
069232-MU
Citation ID:
RRID:MMRRC_069232-MU
Other Names:
R9428 (G1)
Major Collection:

Strain Information

Arc
Name: activity regulated cytoskeletal-associated protein
Synonyms: Arc3.1, arg 3.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11838
HGNC: HGNC:648
Homologene: 9056
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Ahdc1
Name: AT hook, DNA binding motif, containing 1
Synonyms: D030015G18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230793
Homologene: 17144
Chgb
Name: chromogranin B
Synonyms: secretogranin I, Scg-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12653
HGNC: HGNC:1930
Homologene: 1375
Nr4a1
Name: nuclear receptor subfamily 4, group A, member 1
Synonyms: Nur77, TIS1, TR3, N10, NP10, GFRP1, NGFI-B, Hbr-1, Gfrp, Hbr1, Hmr
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15370
VEGA: 15
HGNC: HGNC:7980
Homologene: 1612
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 54,536,047 bp (GRCm38)
  • G to T, chromosome 1 at 75,216,042 bp (GRCm38)
  • A to G, chromosome 1 at 91,345,873 bp (GRCm38)
  • A to T, chromosome 1 at 130,653,357 bp (GRCm38)
  • T to A, chromosome 1 at 138,113,747 bp (GRCm38)
  • T to C, chromosome 1 at 181,353,292 bp (GRCm38)
  • A to G, chromosome 1 at 188,443,119 bp (GRCm38)
  • T to C, chromosome 2 at 21,783,161 bp (GRCm38)
  • T to A, chromosome 2 at 34,717,306 bp (GRCm38)
  • T to C, chromosome 2 at 59,771,204 bp (GRCm38)
  • T to C, chromosome 2 at 87,635,430 bp (GRCm38)
  • C to T, chromosome 2 at 113,836,934 bp (GRCm38)
  • T to A, chromosome 2 at 118,877,888 bp (GRCm38)
  • T to C, chromosome 2 at 126,829,220 bp (GRCm38)
  • C to G, chromosome 2 at 132,793,234 bp (GRCm38)
  • AC to A, chromosome 3 at 56,090,972 bp (GRCm38)
  • G to A, chromosome 3 at 95,033,456 bp (GRCm38)
  • T to A, chromosome 3 at 123,546,869 bp (GRCm38)
  • T to C, chromosome 4 at 109,000,924 bp (GRCm38)
  • T to C, chromosome 4 at 125,126,765 bp (GRCm38)
  • C to T, chromosome 4 at 133,064,462 bp (GRCm38)
  • A to T, chromosome 4 at 152,039,652 bp (GRCm38)
  • T to C, chromosome 4 at 152,108,323 bp (GRCm38)
  • G to T, chromosome 5 at 95,801,686 bp (GRCm38)
  • T to A, chromosome 5 at 120,749,511 bp (GRCm38)
  • C to T, chromosome 5 at 121,853,084 bp (GRCm38)
  • A to T, chromosome 6 at 57,390,550 bp (GRCm38)
  • T to A, chromosome 6 at 108,401,347 bp (GRCm38)
  • CGGCCAATAGAAGAAACTTTTACCTTCAAGCAGTGAGAACTGGC to CGGC, chromosome 7 at 10,099,785 bp (GRCm38)
  • A to T, chromosome 7 at 18,840,025 bp (GRCm38)
  • A to T, chromosome 7 at 33,744,068 bp (GRCm38)
  • A to T, chromosome 7 at 50,853,935 bp (GRCm38)
  • A to T, chromosome 7 at 109,829,138 bp (GRCm38)
  • A to T, chromosome 7 at 131,066,478 bp (GRCm38)
  • A to T, chromosome 7 at 138,209,761 bp (GRCm38)
  • A to C, chromosome 7 at 141,808,822 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • A to T, chromosome 8 at 63,940,033 bp (GRCm38)
  • T to A, chromosome 9 at 106,858,329 bp (GRCm38)
  • T to A, chromosome 10 at 4,353,409 bp (GRCm38)
  • T to A, chromosome 10 at 20,357,293 bp (GRCm38)
  • T to C, chromosome 10 at 52,081,965 bp (GRCm38)
  • T to A, chromosome 10 at 82,377,656 bp (GRCm38)
  • T to C, chromosome 10 at 109,769,315 bp (GRCm38)
  • A to G, chromosome 11 at 65,008,342 bp (GRCm38)
  • T to C, chromosome 11 at 94,503,169 bp (GRCm38)
  • T to C, chromosome 11 at 95,120,604 bp (GRCm38)
  • T to A, chromosome 11 at 98,189,223 bp (GRCm38)
  • T to C, chromosome 11 at 106,008,995 bp (GRCm38)
  • A to G, chromosome 12 at 37,405,331 bp (GRCm38)
  • G to A, chromosome 13 at 23,011,774 bp (GRCm38)
  • A to T, chromosome 13 at 23,076,579 bp (GRCm38)
  • A to T, chromosome 13 at 24,111,851 bp (GRCm38)
  • A to G, chromosome 13 at 97,099,216 bp (GRCm38)
  • A to T, chromosome 14 at 20,725,402 bp (GRCm38)
  • T to C, chromosome 14 at 30,872,688 bp (GRCm38)
  • T to C, chromosome 14 at 33,550,053 bp (GRCm38)
  • A to C, chromosome 14 at 47,251,970 bp (GRCm38)
  • G to A, chromosome 14 at 47,290,577 bp (GRCm38)
  • A to G, chromosome 14 at 56,696,657 bp (GRCm38)
  • A to G, chromosome 14 at 101,917,640 bp (GRCm38)
  • A to G, chromosome 15 at 74,671,214 bp (GRCm38)
  • A to G, chromosome 15 at 76,183,521 bp (GRCm38)
  • A to T, chromosome 15 at 85,931,348 bp (GRCm38)
  • G to A, chromosome 15 at 89,100,897 bp (GRCm38)
  • T to C, chromosome 15 at 101,270,364 bp (GRCm38)
  • A to T, chromosome 17 at 29,139,341 bp (GRCm38)
  • G to A, chromosome 17 at 34,730,911 bp (GRCm38)
  • A to G, chromosome 17 at 46,712,065 bp (GRCm38)
  • G to T, chromosome 17 at 84,566,413 bp (GRCm38)
  • T to A, chromosome 17 at 87,133,639 bp (GRCm38)
  • A to G, chromosome 18 at 36,677,246 bp (GRCm38)
  • A to G, chromosome 19 at 11,757,738 bp (GRCm38)
  • A to T, chromosome 19 at 24,272,423 bp (GRCm38)
  • C to T, chromosome 19 at 33,517,674 bp (GRCm38)
  • C to A, chromosome 19 at 53,310,782 bp (GRCm38)
  • G to C, chromosome 19 at 53,628,719 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9428 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069232-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.