Strain Name:
C57BL/6J-MtgxR9429Btlr/Mmmh
Stock Number:
069233-MU
Citation ID:
RRID:MMRRC_069233-MU
Other Names:
R9429 (G1)
Major Collection:

Strain Information

Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Nrg1
Name: neuregulin 1
Synonyms: heregulin, D230005F13Rik, ARIA, SMDF, HRGalpha, 6030402G23Rik, GGF, NDF, GGFII, HGL, Hgl, HRG
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: C77840, PTD010, 1010001P14Rik, Tmbim5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Tcf3
Name: transcription factor 3
Synonyms: Pan1, bHLHb21, A1, Pan2, E2A, ALF2, E12, E47, Tcfe2a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21423
Homologene: 2408
Urb2
Name: URB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382038
Homologene: 8859
Rrp15
Name: ribosomal RNA processing 15 homolog
Synonyms: 5430437H21Rik, 2810430M08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67223
Homologene: 32293
Septin11
Name: septin 11
Synonyms: D5Ertd606e, 6230410I01Rik, Sept11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52398
Homologene: 56800
Atxn10
Name: ataxin 10
Synonyms: E46, Tex169, Sca10, TEG-169
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54138
VEGA: 15
Homologene: 40858
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, D8Ertd790e, kidney, anemia and testis
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Kctd2
Name: potassium channel tetramerisation domain containing 2
Synonyms: 2310012I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70382
Homologene: 82389
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Zfta
Name: zinc finger translocation associated
Synonyms: 2700081O15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108899
Homologene: 52179
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: Dnahc1, G1-415-19, MDHC7, ferf1, B230373P09Rik, E030034C22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Cd202b, Hyk, Tie2, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Frmd4b
Name: FERM domain containing 4B
Synonyms: GRSP1, 6030440G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Zfp750
Name: zinc finger protein 750
Synonyms: A030007D23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319530
Homologene: 36423
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Atmin
Name: ATM interactor
Synonyms: Asciz, gpg6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234776
Homologene: 35321
Spata31
Name: spermatogenesis associated 31
Synonyms: Spata31a, 4930458L03Rik, Fam75a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Catsper1
Name: cation channel, sperm associated 1
Synonyms: KSper
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225865
VEGA: 19
Homologene: 14207
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Pter
Name: phosphotriesterase related
Synonyms: Mpr56-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19212
HGNC: HGNC:9590
Homologene: 7495
Fhod1
Name: formin homology 2 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234686
Homologene: 136406
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mass1, Gpr98, VLGR1, Mgr1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: Heatr7b2, 4930455B06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Per2
Name: period circadian clock 2
Synonyms: mPer2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18627
HGNC: HGNC:8846
Homologene: 7885
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trcp3, Trp3, Trrp3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22065
Homologene: 20708
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2810426P10Rik, 2310045H19Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Erich6
Name: glutamate rich 6
Synonyms: Fam194a, 4932431H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Myo1a
Name: myosin IA
Synonyms: brush border myosin 1, BBM-I, Myhl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Foxh1
Name: forkhead box H1
Synonyms: Fast2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14106
VEGA: 15
HGNC: HGNC:3814
Homologene: 2914
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Acte1
Name: actin, epsilon 1
Synonyms: Gm498, LOC244239
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102636989
Homologene: 131918
L3hypdh
Name: L-3-hydroxyproline dehydratase (trans-)
Synonyms: 2810055F11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67217
Homologene: 12100
Or52s1
Name: olfactory receptor family 52 subfamily S member 1
Synonyms: GA_x6K02T2PBJ9-5927412-5928362, Olfr593, MOR24-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258378
Homologene: 27147
Oasl2
Name: 2'-5' oligoadenylate synthetase-like 2
Synonyms: Mmu-OASL, M1204
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23962
Homologene: 128369
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Or5e1
Name: olfactory receptor family 5 subfamily E member 1
Synonyms: MOR195-1, GA_x6K02T2PBJ9-11084889-11085818, Olfr513
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258718
Homologene: 64908
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Beethoven, Bth, 4933416G09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Laptm5
Name: lysosomal-associated protein transmembrane 5
Synonyms: E3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16792
Homologene: 4922
Phyhd1
Name: phytanoyl-CoA dioxygenase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227696
Homologene: 14939
5930422O12Rik
Name: RIKEN cDNA 5930422O12 gene
Type: Gene
Species: Mouse
Chromosome: 8
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Themis3
Name: thymocyte selection associated family member 3
Synonyms: 9130404H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74556
Homologene: 137389
Vmn1r90
Name: vomeronasal 1 receptor 90
Synonyms: B430211C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 627280
Homologene: 122945
Dusp10
Name: dual specificity phosphatase 10
Synonyms: MKP-5, MKP5, 2610306G15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63953
HGNC: HGNC:3065
Homologene: 5215
Cma2
Name: chymase 2, mast cell
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545055
VEGA: 14
Homologene: 115745
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Vav3
Name: vav 3 oncogene
Synonyms: Idd18.1, A530094I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Aebp1
Name: AE binding protein 1
Synonyms: ACLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11568
HGNC: HGNC:303
Homologene: 878
Nt5c2
Name: 5'-nucleotidase, cytosolic II
Synonyms: cN-II, PNT5, NT5B
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76952
HGNC: HGNC:8022
Homologene: 8158
Ston1
Name: stonin 1
Synonyms: 4921524J06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77057
Homologene: 122152
Zfp72
Name: zinc finger protein 72
Synonyms: Zfp74
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238722
VEGA: 13
Homologene: 108290
Vmn1r32
Name: vomeronasal 1 receptor 32
Synonyms: V1rc15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171188
Homologene: 115644
Or13a1
Name: olfactory receptor family 13 subfamily A member 1
Synonyms: MOR253-9, GA_x54KRFPKN04-58127726-58128655, Olfr211
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258914
Homologene: 17434
Sowahb
Name: sosondowah ankyrin repeat domain family member B
Synonyms: 5730467H21Rik, Ankrd56
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78088
Homologene: 18429
Sepsecs
Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms: SLA, D5Ertd135e, SecS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211006
Homologene: 15031
Ttll2
Name: tubulin tyrosine ligase-like family, member 2
Synonyms: EG625850
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100216474
VEGA: 17
Homologene: 12917
Ms4a12
Name: membrane-spanning 4-domains, subfamily A, member 12
Synonyms: LOC381213
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381213
Homologene: 130690
Gm38394
Name: predicted gene, 38394
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 90,803,863 bp (GRCm38)
  • T to C, chromosome 1 at 91,423,767 bp (GRCm38)
  • A to C, chromosome 1 at 133,657,715 bp (GRCm38)
  • A to C, chromosome 1 at 179,605,001 bp (GRCm38)
  • A to C, chromosome 1 at 184,068,894 bp (GRCm38)
  • A to T, chromosome 1 at 186,749,171 bp (GRCm38)
  • T to A, chromosome 2 at 12,980,301 bp (GRCm38)
  • C to A, chromosome 2 at 30,266,905 bp (GRCm38)
  • C to T, chromosome 2 at 181,996,141 bp (GRCm38)
  • T to G, chromosome 3 at 36,651,628 bp (GRCm38)
  • A to G, chromosome 3 at 58,629,514 bp (GRCm38)
  • T to A, chromosome 3 at 109,657,245 bp (GRCm38)
  • A to T, chromosome 4 at 47,310,439 bp (GRCm38)
  • A to G, chromosome 4 at 94,827,278 bp (GRCm38)
  • A to G, chromosome 4 at 130,928,650 bp (GRCm38)
  • A to C, chromosome 4 at 133,871,589 bp (GRCm38)
  • T to C, chromosome 4 at 152,362,907 bp (GRCm38)
  • T to C, chromosome 5 at 52,643,952 bp (GRCm38)
  • T to C, chromosome 5 at 93,043,221 bp (GRCm38)
  • G to A, chromosome 5 at 93,173,538 bp (GRCm38)
  • A to T, chromosome 5 at 109,676,468 bp (GRCm38)
  • G to A, chromosome 5 at 114,904,979 bp (GRCm38)
  • T to A, chromosome 6 at 66,553,253 bp (GRCm38)
  • T to C, chromosome 6 at 97,302,291 bp (GRCm38)
  • T to G, chromosome 6 at 116,494,331 bp (GRCm38)
  • A to T, chromosome 7 at 14,561,722 bp (GRCm38)
  • C to T, chromosome 7 at 103,212,664 bp (GRCm38)
  • G to T, chromosome 7 at 108,755,205 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • T to C, chromosome 8 at 24,547,178 bp (GRCm38)
  • T to A, chromosome 8 at 31,818,564 bp (GRCm38)
  • A to T, chromosome 8 at 33,429,137 bp (GRCm38)
  • C to T, chromosome 8 at 61,106,858 bp (GRCm38)
  • A to G, chromosome 8 at 105,330,507 bp (GRCm38)
  • A to T, chromosome 8 at 105,383,020 bp (GRCm38)
  • A to G, chromosome 8 at 116,943,568 bp (GRCm38)
  • T to A, chromosome 8 at 124,023,487 bp (GRCm38)
  • G to A, chromosome 10 at 80,416,602 bp (GRCm38)
  • G to T, chromosome 10 at 127,707,378 bp (GRCm38)
  • A to G, chromosome 11 at 5,871,649 bp (GRCm38)
  • T to C, chromosome 11 at 115,427,451 bp (GRCm38)
  • G to A, chromosome 11 at 121,513,867 bp (GRCm38)
  • T to C, chromosome 12 at 72,077,429 bp (GRCm38)
  • A to G, chromosome 13 at 11,794,573 bp (GRCm38)
  • C to A, chromosome 13 at 64,922,522 bp (GRCm38)
  • A to G, chromosome 13 at 74,372,584 bp (GRCm38)
  • A to T, chromosome 13 at 81,419,349 bp (GRCm38)
  • A to C, chromosome 13 at 81,593,046 bp (GRCm38)
  • G to A, chromosome 14 at 31,275,542 bp (GRCm38)
  • A to G, chromosome 14 at 37,130,698 bp (GRCm38)
  • A to G, chromosome 14 at 55,972,819 bp (GRCm38)
  • G to C, chromosome 14 at 68,533,631 bp (GRCm38)
  • T to A, chromosome 15 at 4,934,425 bp (GRCm38)
  • C to T, chromosome 15 at 76,669,242 bp (GRCm38)
  • A to G, chromosome 15 at 85,462,364 bp (GRCm38)
  • C to T, chromosome 16 at 32,755,724 bp (GRCm38)
  • T to A, chromosome 16 at 59,555,193 bp (GRCm38)
  • G to A, chromosome 16 at 70,495,315 bp (GRCm38)
  • A to T, chromosome 17 at 7,352,686 bp (GRCm38)
  • T to C, chromosome 17 at 66,559,670 bp (GRCm38)
  • A to G, chromosome 17 at 67,811,454 bp (GRCm38)
  • A to G, chromosome 17 at 88,635,606 bp (GRCm38)
  • T to C, chromosome 19 at 5,339,727 bp (GRCm38)
  • T to C, chromosome 19 at 7,422,229 bp (GRCm38)
  • T to C, chromosome 19 at 11,216,060 bp (GRCm38)
  • T to A, chromosome 19 at 20,816,184 bp (GRCm38)
  • C to T, chromosome 19 at 30,113,772 bp (GRCm38)
  • T to A, chromosome 19 at 46,889,020 bp (GRCm38)
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9429 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069233-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.