Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9429Btlr/Mmmh
Stock Number:
069233-MU
Citation ID:
RRID:MMRRC_069233-MU
Other Names:
R9429 (G1)
Major Collection:

Strain Information

Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: PTD010, 1010001P14Rik, C77840, Tmbim5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Tcf3
Name: transcription factor 3
Synonyms: ALF2, E2A, E47, E12, Pan2, Pan1, A1, Tcfe2a, bHLHb21
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21423
Homologene: 2408
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 90,803,863 bp (GRCm38)
  • T to C, chromosome 1 at 91,423,767 bp (GRCm38)
  • A to C, chromosome 1 at 133,657,715 bp (GRCm38)
  • A to C, chromosome 1 at 179,605,001 bp (GRCm38)
  • A to C, chromosome 1 at 184,068,894 bp (GRCm38)
  • A to T, chromosome 1 at 186,749,171 bp (GRCm38)
  • T to A, chromosome 2 at 12,980,301 bp (GRCm38)
  • C to A, chromosome 2 at 30,266,905 bp (GRCm38)
  • C to T, chromosome 2 at 181,996,141 bp (GRCm38)
  • T to G, chromosome 3 at 36,651,628 bp (GRCm38)
  • A to G, chromosome 3 at 58,629,514 bp (GRCm38)
  • T to A, chromosome 3 at 109,657,245 bp (GRCm38)
  • A to T, chromosome 4 at 47,310,439 bp (GRCm38)
  • A to G, chromosome 4 at 94,827,278 bp (GRCm38)
  • A to G, chromosome 4 at 130,928,650 bp (GRCm38)
  • A to C, chromosome 4 at 133,871,589 bp (GRCm38)
  • T to C, chromosome 4 at 152,362,907 bp (GRCm38)
  • T to C, chromosome 5 at 52,643,952 bp (GRCm38)
  • T to C, chromosome 5 at 93,043,221 bp (GRCm38)
  • G to A, chromosome 5 at 93,173,538 bp (GRCm38)
  • A to T, chromosome 5 at 109,676,468 bp (GRCm38)
  • G to A, chromosome 5 at 114,904,979 bp (GRCm38)
  • T to A, chromosome 6 at 66,553,253 bp (GRCm38)
  • T to C, chromosome 6 at 97,302,291 bp (GRCm38)
  • T to G, chromosome 6 at 116,494,331 bp (GRCm38)
  • A to T, chromosome 7 at 14,561,722 bp (GRCm38)
  • C to T, chromosome 7 at 103,212,664 bp (GRCm38)
  • G to T, chromosome 7 at 108,755,205 bp (GRCm38)
  • G to T, chromosome 7 at 143,881,165 bp (GRCm38)
  • T to C, chromosome 8 at 24,547,178 bp (GRCm38)
  • T to A, chromosome 8 at 31,818,564 bp (GRCm38)
  • A to T, chromosome 8 at 33,429,137 bp (GRCm38)
  • C to T, chromosome 8 at 61,106,858 bp (GRCm38)
  • A to G, chromosome 8 at 105,330,507 bp (GRCm38)
  • A to T, chromosome 8 at 105,383,020 bp (GRCm38)
  • A to G, chromosome 8 at 116,943,568 bp (GRCm38)
  • T to A, chromosome 8 at 124,023,487 bp (GRCm38)
  • G to A, chromosome 10 at 80,416,602 bp (GRCm38)
  • G to T, chromosome 10 at 127,707,378 bp (GRCm38)
  • A to G, chromosome 11 at 5,871,649 bp (GRCm38)
  • T to C, chromosome 11 at 115,427,451 bp (GRCm38)
  • G to A, chromosome 11 at 121,513,867 bp (GRCm38)
  • T to C, chromosome 12 at 72,077,429 bp (GRCm38)
  • A to G, chromosome 13 at 11,794,573 bp (GRCm38)
  • C to A, chromosome 13 at 64,922,522 bp (GRCm38)
  • A to G, chromosome 13 at 74,372,584 bp (GRCm38)
  • A to T, chromosome 13 at 81,419,349 bp (GRCm38)
  • A to C, chromosome 13 at 81,593,046 bp (GRCm38)
  • G to A, chromosome 14 at 31,275,542 bp (GRCm38)
  • A to G, chromosome 14 at 37,130,698 bp (GRCm38)
  • A to G, chromosome 14 at 55,972,819 bp (GRCm38)
  • G to C, chromosome 14 at 68,533,631 bp (GRCm38)
  • T to A, chromosome 15 at 4,934,425 bp (GRCm38)
  • C to T, chromosome 15 at 76,669,242 bp (GRCm38)
  • A to G, chromosome 15 at 85,462,364 bp (GRCm38)
  • C to T, chromosome 16 at 32,755,724 bp (GRCm38)
  • T to A, chromosome 16 at 59,555,193 bp (GRCm38)
  • G to A, chromosome 16 at 70,495,315 bp (GRCm38)
  • A to T, chromosome 17 at 7,352,686 bp (GRCm38)
  • T to C, chromosome 17 at 66,559,670 bp (GRCm38)
  • A to G, chromosome 17 at 67,811,454 bp (GRCm38)
  • A to G, chromosome 17 at 88,635,606 bp (GRCm38)
  • T to C, chromosome 19 at 5,339,727 bp (GRCm38)
  • T to C, chromosome 19 at 7,422,229 bp (GRCm38)
  • T to C, chromosome 19 at 11,216,060 bp (GRCm38)
  • T to A, chromosome 19 at 20,816,184 bp (GRCm38)
  • C to T, chromosome 19 at 30,113,772 bp (GRCm38)
  • T to A, chromosome 19 at 46,889,020 bp (GRCm38)
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9429 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069233-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.