Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9435Btlr/Mmmh
Stock Number:
069239-MU
Citation ID:
RRID:MMRRC_069239-MU
Other Names:
R9435 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Prim2
Name: DNA primase, p58 subunit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19076
HGNC: HGNC:9370
Homologene: 731
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 8,363,590 bp (GRCm38)
  • T to C, chromosome 1 at 33,484,795 bp (GRCm38)
  • T to A, chromosome 1 at 97,894,419 bp (GRCm38)
  • C to T, chromosome 1 at 121,441,855 bp (GRCm38)
  • T to A, chromosome 1 at 131,839,158 bp (GRCm38)
  • T to A, chromosome 1 at 136,473,436 bp (GRCm38)
  • T to C, chromosome 1 at 153,137,326 bp (GRCm38)
  • A to G, chromosome 1 at 166,309,122 bp (GRCm38)
  • A to T, chromosome 1 at 185,302,716 bp (GRCm38)
  • C to G, chromosome 1 at 195,085,412 bp (GRCm38)
  • T to A, chromosome 2 at 14,115,990 bp (GRCm38)
  • C to T, chromosome 2 at 90,729,794 bp (GRCm38)
  • A to G, chromosome 2 at 91,206,064 bp (GRCm38)
  • A to T, chromosome 2 at 93,437,395 bp (GRCm38)
  • G to T, chromosome 2 at 154,143,923 bp (GRCm38)
  • T to A, chromosome 3 at 56,035,888 bp (GRCm38)
  • A to G, chromosome 3 at 90,602,195 bp (GRCm38)
  • T to C, chromosome 3 at 95,589,058 bp (GRCm38)
  • T to A, chromosome 4 at 88,348,839 bp (GRCm38)
  • A to G, chromosome 4 at 134,234,574 bp (GRCm38)
  • G to C, chromosome 4 at 145,622,475 bp (GRCm38)
  • T to C, chromosome 4 at 148,668,509 bp (GRCm38)
  • T to C, chromosome 5 at 41,762,150 bp (GRCm38)
  • G to T, chromosome 6 at 41,863,861 bp (GRCm38)
  • A to T, chromosome 6 at 49,827,501 bp (GRCm38)
  • T to A, chromosome 6 at 133,036,723 bp (GRCm38)
  • T to A, chromosome 7 at 29,190,326 bp (GRCm38)
  • T to C, chromosome 7 at 104,996,739 bp (GRCm38)
  • T to A, chromosome 7 at 121,067,249 bp (GRCm38)
  • GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG to GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG, chromosome 7 at 142,212,045 bp (GRCm38)
  • A to G, chromosome 9 at 39,426,210 bp (GRCm38)
  • G to A, chromosome 9 at 66,848,630 bp (GRCm38)
  • T to C, chromosome 9 at 72,319,317 bp (GRCm38)
  • C to A, chromosome 9 at 106,568,453 bp (GRCm38)
  • T to C, chromosome 9 at 107,519,185 bp (GRCm38)
  • C to T, chromosome 9 at 111,364,822 bp (GRCm38)
  • T to A, chromosome 10 at 12,643,429 bp (GRCm38)
  • T to C, chromosome 10 at 67,539,798 bp (GRCm38)
  • T to A, chromosome 10 at 81,179,160 bp (GRCm38)
  • G to A, chromosome 10 at 128,495,197 bp (GRCm38)
  • T to C, chromosome 11 at 60,468,140 bp (GRCm38)
  • C to T, chromosome 11 at 110,292,085 bp (GRCm38)
  • A to C, chromosome 11 at 116,005,029 bp (GRCm38)
  • C to T, chromosome 11 at 121,830,820 bp (GRCm38)
  • T to G, chromosome 12 at 21,270,942 bp (GRCm38)
  • G to A, chromosome 13 at 24,937,310 bp (GRCm38)
  • A to T, chromosome 13 at 59,474,615 bp (GRCm38)
  • A to T, chromosome 14 at 32,660,605 bp (GRCm38)
  • A to T, chromosome 14 at 39,472,599 bp (GRCm38)
  • G to T, chromosome 14 at 79,427,504 bp (GRCm38)
  • T to C, chromosome 15 at 85,922,334 bp (GRCm38)
  • T to C, chromosome 17 at 14,945,125 bp (GRCm38)
  • T to A, chromosome 17 at 18,022,129 bp (GRCm38)
  • A to T, chromosome 19 at 5,109,634 bp (GRCm38)
  • A to C, chromosome 19 at 37,597,097 bp (GRCm38)
  • C to A, chromosome 19 at 41,603,325 bp (GRCm38)
  • T to C, chromosome 19 at 46,279,993 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9435 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069239-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.