Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9435Btlr/Mmmh
Stock Number:
069239-MU
Citation ID:
RRID:MMRRC_069239-MU
Other Names:
R9435 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Prim2
Name: DNA primase, p58 subunit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19076
HGNC: HGNC:9370
Homologene: 731
Exoc6
Name: exocyst complex component 6
Synonyms: msec15, 4833405E05Rik, Sec15, Sec15l1, hbd
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107371
VEGA: 19
Homologene: 41305
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70829
Homologene: 10393
Golph3l
Name: golgi phosphoprotein 3-like
Synonyms: GPP34R, 2010204I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229593
Homologene: 23082
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Drg2
Name: developmentally regulated GTP binding protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13495
HGNC: HGNC:3030
Homologene: 1061
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Zfp268
Name: zinc finger protein 268
Synonyms: Gm13212
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433801
Homologene: 133076
Phf10
Name: PHD finger protein 10
Synonyms: 1810055P05Rik, Baf45a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72057
Homologene: 10112
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67269
Homologene: 9067
Cd82
Name: CD82 antigen
Synonyms: C33, Tspan27, Kai1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12521
HGNC: HGNC:6210
Homologene: 20512
Npy
Name: neuropeptide Y
Synonyms: 0710005A05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109648
HGNC: HGNC:7955
Homologene: 697
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Klc2
Name: kinesin light chain 2
Synonyms: 8030455F02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16594
Homologene: 22468
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Ptchd3
Name: patched domain containing 3
Synonyms: 4933440L20Rik, 4930451E13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74675
Homologene: 111041
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Egr2
Name: early growth response 2
Synonyms: Krox20, Egr-2, Krox-20, Zfp-25, NGF1-B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13654
HGNC: HGNC:3239
Homologene: 20123
Or8g33
Name: olfactory receptor family 8 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-33124064-33123120, MOR171-21, Olfr952
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235248
VEGA: 9
Homologene: 133698
Ildr2
Name: immunoglobulin-like domain containing receptor 2
Synonyms: 3110063L10Rik, 2810478N18Rik, OTTMUSG00000021748, ENSMUSG00000040612, Dbsm1, D1Ertd471e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039795
Homologene: 52388
Pam
Name: peptidylglycine alpha-amidating monooxygenase
Synonyms: PHM
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18484
HGNC: HGNC:8596
Homologene: 37369
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Igsf6
Name: immunoglobulin superfamily, member 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80719
HGNC: HGNC:5953
Homologene: 36189
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Nrg3
Name: neuregulin 3
Synonyms: ska
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18183
HGNC: HGNC:7999
Homologene: 32051
Fpr-rs4
Name: formyl peptide receptor, related sequence 4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14291
Homologene: 130629
Bpifa1
Name: BPI fold containing family A, member 1
Synonyms: SPLUNC1, Plunc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18843
Homologene: 7895
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Synonyms: CEFIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Slc41a1
Name: solute carrier family 41, member 1
Synonyms: B230315F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98396
Homologene: 14871
Cd46
Name: CD46 antigen, complement regulatory protein
Synonyms: CD46, Mcp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17221
HGNC: HGNC:6953
Homologene: 7832
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Tas2r103
Name: taste receptor, type 2, member 103
Synonyms: TRB2, T2R3, mt2r63, mGR03, Tas2r3, Tas2r10, EG667992
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667992
Homologene: 130076
Or52e15
Name: olfactory receptor family 52 subfamily E member 15
Synonyms: GA_x6K02T2PBJ9-7625746-7624808, MOR32-4, Olfr672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258755
Homologene: 138317
Itgb1bp1
Name: integrin beta 1 binding protein 1
Synonyms: bodenin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16413
Homologene: 3496
Aldh5a1
Name: aldhehyde dehydrogenase family 5, subfamily A1
Synonyms: D630032B01Rik, OTTMUSG00000000613, 6330403E24Rik, SSADH
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214579
HGNC: HGNC:408
Homologene: 840
Nkx3-2
Name: NK3 homeobox 2
Synonyms: Nkx-3.2, Bapx1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12020
HGNC: HGNC:951
Homologene: 68168
Acp2
Name: acid phosphatase 2, lysosomal
Synonyms: Acp-2, LAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11432
HGNC: HGNC:123
Homologene: 1217
Iqcf4
Name: IQ motif containing F4
Synonyms: 1700042N06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67320
Homologene: 122079
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194231
Homologene: 4604
Ciroz
Name: ciliated left-right organizer protein containing ZP-N domains
Synonyms: LOC230909, b2b1167Clo, Gm572
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230909
Homologene: 52134
Kbtbd7
Name: kelch repeat and BTB (POZ) domain containing 7
Synonyms: LOC211255, 1110008P08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211255
VEGA: 14
Homologene: 41849
Rab8b
Name: RAB8B, member RAS oncogene family
Synonyms: Rab8b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235442
VEGA: 9
Homologene: 69220
Sval2
Name: seminal vesicle antigen-like 2
Synonyms: SLP-M
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 84543
HGNC: HGNC:8993
Homologene: 13055
S100a3
Name: S100 calcium binding protein A3
Synonyms: S100E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20197
Homologene: 2223
Myl6b
Name: myosin, light polypeptide 6B
Synonyms: 5730437E04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216459
VEGA: 10
Homologene: 86887
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 8,363,590 bp (GRCm38)
  • T to C, chromosome 1 at 33,484,795 bp (GRCm38)
  • T to A, chromosome 1 at 97,894,419 bp (GRCm38)
  • C to T, chromosome 1 at 121,441,855 bp (GRCm38)
  • T to A, chromosome 1 at 131,839,158 bp (GRCm38)
  • T to A, chromosome 1 at 136,473,436 bp (GRCm38)
  • T to C, chromosome 1 at 153,137,326 bp (GRCm38)
  • A to G, chromosome 1 at 166,309,122 bp (GRCm38)
  • A to T, chromosome 1 at 185,302,716 bp (GRCm38)
  • C to G, chromosome 1 at 195,085,412 bp (GRCm38)
  • T to A, chromosome 2 at 14,115,990 bp (GRCm38)
  • C to T, chromosome 2 at 90,729,794 bp (GRCm38)
  • A to G, chromosome 2 at 91,206,064 bp (GRCm38)
  • A to T, chromosome 2 at 93,437,395 bp (GRCm38)
  • G to T, chromosome 2 at 154,143,923 bp (GRCm38)
  • T to A, chromosome 3 at 56,035,888 bp (GRCm38)
  • A to G, chromosome 3 at 90,602,195 bp (GRCm38)
  • T to C, chromosome 3 at 95,589,058 bp (GRCm38)
  • T to A, chromosome 4 at 88,348,839 bp (GRCm38)
  • A to G, chromosome 4 at 134,234,574 bp (GRCm38)
  • G to C, chromosome 4 at 145,622,475 bp (GRCm38)
  • T to C, chromosome 4 at 148,668,509 bp (GRCm38)
  • T to C, chromosome 5 at 41,762,150 bp (GRCm38)
  • G to T, chromosome 6 at 41,863,861 bp (GRCm38)
  • A to T, chromosome 6 at 49,827,501 bp (GRCm38)
  • T to A, chromosome 6 at 133,036,723 bp (GRCm38)
  • T to A, chromosome 7 at 29,190,326 bp (GRCm38)
  • T to C, chromosome 7 at 104,996,739 bp (GRCm38)
  • T to A, chromosome 7 at 121,067,249 bp (GRCm38)
  • GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG to GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG, chromosome 7 at 142,212,045 bp (GRCm38)
  • A to G, chromosome 9 at 39,426,210 bp (GRCm38)
  • G to A, chromosome 9 at 66,848,630 bp (GRCm38)
  • T to C, chromosome 9 at 72,319,317 bp (GRCm38)
  • C to A, chromosome 9 at 106,568,453 bp (GRCm38)
  • T to C, chromosome 9 at 107,519,185 bp (GRCm38)
  • C to T, chromosome 9 at 111,364,822 bp (GRCm38)
  • T to A, chromosome 10 at 12,643,429 bp (GRCm38)
  • T to C, chromosome 10 at 67,539,798 bp (GRCm38)
  • T to A, chromosome 10 at 81,179,160 bp (GRCm38)
  • G to A, chromosome 10 at 128,495,197 bp (GRCm38)
  • T to C, chromosome 11 at 60,468,140 bp (GRCm38)
  • C to T, chromosome 11 at 110,292,085 bp (GRCm38)
  • A to C, chromosome 11 at 116,005,029 bp (GRCm38)
  • C to T, chromosome 11 at 121,830,820 bp (GRCm38)
  • T to G, chromosome 12 at 21,270,942 bp (GRCm38)
  • G to A, chromosome 13 at 24,937,310 bp (GRCm38)
  • A to T, chromosome 13 at 59,474,615 bp (GRCm38)
  • A to T, chromosome 14 at 32,660,605 bp (GRCm38)
  • A to T, chromosome 14 at 39,472,599 bp (GRCm38)
  • G to T, chromosome 14 at 79,427,504 bp (GRCm38)
  • T to C, chromosome 15 at 85,922,334 bp (GRCm38)
  • T to C, chromosome 17 at 14,945,125 bp (GRCm38)
  • T to A, chromosome 17 at 18,022,129 bp (GRCm38)
  • A to T, chromosome 19 at 5,109,634 bp (GRCm38)
  • A to C, chromosome 19 at 37,597,097 bp (GRCm38)
  • C to A, chromosome 19 at 41,603,325 bp (GRCm38)
  • T to C, chromosome 19 at 46,279,993 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9435 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069239-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.