Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9441Btlr/Mmmh
Stock Number:
069245-MU
Citation ID:
RRID:MMRRC_069245-MU
Other Names:
R9441 (G1)
Major Collection:

Strain Information

Eno1
Name: enolase 1, alpha non-neuron
Synonyms: 2-phospho-D-glycerate hydrolase, alpha-enolase, Eno-1, MBP-1, c-Myc promoter binding protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13806
HGNC: HGNC:3350
Homologene: 134343
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Hip1
Name: huntingtin interacting protein 1
Synonyms: 2610109B09Rik, A930014B11Rik, E130315I21Rik, HIP-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215114
HGNC: HGNC:4913
Homologene: 68463
Serbp1
Name: serpine1 mRNA binding protein 1
Synonyms: 9330147J08Rik, 1200009K13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66870
Homologene: 134277
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Cdmx, Atx, Mbx, Dmbx1, Otx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140477
Homologene: 15639
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 13,701,363 bp (GRCm38)
  • G to C, chromosome 1 at 34,199,351 bp (GRCm38)
  • T to C, chromosome 1 at 36,221,225 bp (GRCm38)
  • C to T, chromosome 1 at 75,186,442 bp (GRCm38)
  • G to T, chromosome 1 at 90,777,527 bp (GRCm38)
  • G to A, chromosome 1 at 97,745,196 bp (GRCm38)
  • T to C, chromosome 1 at 140,102,411 bp (GRCm38)
  • C to G, chromosome 1 at 167,350,350 bp (GRCm38)
  • G to A, chromosome 1 at 171,886,427 bp (GRCm38)
  • A to C, chromosome 2 at 19,248,615 bp (GRCm38)
  • A to T, chromosome 2 at 25,574,738 bp (GRCm38)
  • A to G, chromosome 2 at 126,720,153 bp (GRCm38)
  • T to A, chromosome 2 at 181,347,067 bp (GRCm38)
  • T to A, chromosome 3 at 64,105,253 bp (GRCm38)
  • A to G, chromosome 3 at 107,104,952 bp (GRCm38)
  • T to A, chromosome 3 at 157,910,938 bp (GRCm38)
  • A to G, chromosome 4 at 32,645,873 bp (GRCm38)
  • G to A, chromosome 4 at 59,207,843 bp (GRCm38)
  • A to G, chromosome 4 at 60,139,740 bp (GRCm38)
  • A to T, chromosome 4 at 83,005,846 bp (GRCm38)
  • T to C, chromosome 4 at 113,490,651 bp (GRCm38)
  • G to A, chromosome 4 at 115,923,687 bp (GRCm38)
  • C to T, chromosome 4 at 150,236,751 bp (GRCm38)
  • T to C, chromosome 5 at 8,111,974 bp (GRCm38)
  • T to A, chromosome 5 at 32,937,698 bp (GRCm38)
  • G to T, chromosome 5 at 135,431,717 bp (GRCm38)
  • T to C, chromosome 5 at 137,734,932 bp (GRCm38)
  • A to G, chromosome 6 at 36,524,020 bp (GRCm38)
  • T to C, chromosome 6 at 67,267,041 bp (GRCm38)
  • C to T, chromosome 6 at 92,242,958 bp (GRCm38)
  • T to C, chromosome 7 at 26,814,635 bp (GRCm38)
  • T to C, chromosome 7 at 44,516,906 bp (GRCm38)
  • G to A, chromosome 7 at 139,921,476 bp (GRCm38)
  • G to A, chromosome 7 at 143,569,448 bp (GRCm38)
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp (GRCm38)
  • G to T, chromosome 8 at 104,963,991 bp (GRCm38)
  • G to T, chromosome 8 at 109,993,915 bp (GRCm38)
  • C to A, chromosome 9 at 56,010,492 bp (GRCm38)
  • G to T, chromosome 10 at 7,702,917 bp (GRCm38)
  • A to G, chromosome 10 at 23,864,600 bp (GRCm38)
  • A to T, chromosome 10 at 40,002,684 bp (GRCm38)
  • G to A, chromosome 10 at 60,772,249 bp (GRCm38)
  • G to A, chromosome 10 at 78,519,775 bp (GRCm38)
  • A to G, chromosome 11 at 71,123,108 bp (GRCm38)
  • C to T, chromosome 13 at 116,893,026 bp (GRCm38)
  • G to T, chromosome 14 at 28,080,157 bp (GRCm38)
  • A to G, chromosome 14 at 54,960,314 bp (GRCm38)
  • T to A, chromosome 14 at 68,637,494 bp (GRCm38)
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
  • G to A, chromosome 16 at 58,638,521 bp (GRCm38)
  • A to G, chromosome 17 at 25,311,241 bp (GRCm38)
  • A to T, chromosome 17 at 25,750,757 bp (GRCm38)
  • A to G, chromosome 17 at 81,649,069 bp (GRCm38)
  • G to A, chromosome 18 at 36,683,058 bp (GRCm38)
  • G to A, chromosome 18 at 67,519,392 bp (GRCm38)
  • T to C, chromosome 19 at 6,855,845 bp (GRCm38)
  • A to G, chromosome 19 at 7,603,991 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9441 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069245-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.