Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9441Btlr/Mmmh
Stock Number:
069245-MU
Citation ID:
RRID:MMRRC_069245-MU
Other Names:
R9441 (G1)
Major Collection:

Strain Information

Eno1
Name: enolase 1, alpha non-neuron
Synonyms: 2-phospho-D-glycerate hydrolase, alpha-enolase, Eno-1, MBP-1, c-Myc promoter binding protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13806
HGNC: HGNC:3350
Homologene: 134343
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Hip1
Name: huntingtin interacting protein 1
Synonyms: 2610109B09Rik, A930014B11Rik, E130315I21Rik, HIP-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215114
HGNC: HGNC:4913
Homologene: 68463
Serbp1
Name: serpine1 mRNA binding protein 1
Synonyms: 9330147J08Rik, 1200009K13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66870
Homologene: 134277
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Cdmx, Atx, Mbx, Dmbx1, Otx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140477
Homologene: 15639
Trh
Name: thyrotropin releasing hormone
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22044
Homologene: 5163
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Unc5b
Name: unc-5 netrin receptor B
Synonyms: 6330415E02Rik, Unc5h2, D10Bwg0792e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107449
VEGA: 10
Homologene: 32538
Thap1
Name: THAP domain containing, apoptosis associated protein 1
Synonyms: 4833431A01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73754
Homologene: 10005
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Casp8ap2
Name: caspase 8 associated protein 2
Synonyms: D4Ertd659e, FLASH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26885
HGNC: HGNC:1510
Homologene: 8066
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Usp8
Name: ubiquitin specific peptidase 8
Synonyms: Ubpy
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 84092
Homologene: 3782
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Vip2, Hisppd1, Cfap160
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227399
Homologene: 49409
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: GlcT-1, Epcs21, Ugcgl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70882
Homologene: 31589
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Ces2g
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72361
HGNC: HGNC:1864
Homologene: 77154
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Aldh9a1
Name: aldehyde dehydrogenase 9, subfamily A1
Synonyms: TMABA-DH, ESTM40
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56752
HGNC: HGNC:412
Homologene: 55483
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: V2r83, EG56544
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56544
Homologene: 84832
Xkr9
Name: X-linked Kx blood group related 9
Synonyms: LOC381246
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381246
Homologene: 20056
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Mybpc2
Name: myosin binding protein C, fast-type
Synonyms: Fast-type C-protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233199
HGNC: HGNC:7550
Homologene: 3331
Chrm2
Name: cholinergic receptor, muscarinic 2, cardiac
Synonyms: M2, AChR M2, muscarinic acetylcholine receptor 2, Chrm-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243764
HGNC: HGNC:1951
Homologene: 20190
Cyp2g1
Name: cytochrome P450, family 2, subfamily g, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13108
HGNC: HGNC:2633
Homologene: 75020
Kcna2
Name: potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms: Kv1.2, Kca1-2, Mk-2, Akr6a4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16490
HGNC: HGNC:6220
Homologene: 21034
Lgals12
Name: lectin, galactose binding, soluble 12
Synonyms: galectin-related inhibitor of proliferation, GRIP1, galectin-12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56072
Homologene: 10462
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Prss28
Name: serine protease 28
Synonyms: mIsp-1, Isp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 114661
Homologene: 130906
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Adam28
Name: a disintegrin and metallopeptidase domain 28
Synonyms: Dtgn1, MDC-L, D430033C21Rik, C130072N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13522
VEGA: 14
HGNC: HGNC:206
Homologene: 40705
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Msln
Name: mesothelin
Synonyms: megakaryocyte potentiating factor, MPF, C-ERC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56047
VEGA: 17
HGNC: HGNC:7371
Homologene: 4249
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Spire1
Name: spire type actin nucleation factor 1
Synonyms: Spir-1, 6030430B19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68166
VEGA: 18
Homologene: 35507
Cth
Name: cystathionine gamma lyase
Synonyms: 0610010I13Rik, CSE
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107869
HGNC: HGNC:2501
Homologene: 1432
Tat
Name: tyrosine aminotransferase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234724
Homologene: 37293
Cd84
Name: CD84 antigen
Synonyms: CDw84, SLAMF5, A130013D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12523
HGNC: HGNC:1704
Homologene: 48249
Ftdc2
Name: ferritin domain containing 2
Synonyms: Ftdc, E330017A01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224247
Homologene: 87248
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: Nyap1, 6430598A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243300
Homologene: 18320
Slc35a4
Name: solute carrier family 35, member A4
Synonyms: 2610030J16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67843
Homologene: 12195
Phpt1
Name: phosphohistidine phosphatase 1
Synonyms: 1700008C22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75454
Homologene: 8573
Mfsd4b1
Name: major facilitator superfamily domain containing 4B1
Synonyms: AI317395
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215929
Homologene: 77426
4930563M21Rik
Name: RIKEN cDNA 4930563M21 gene
Synonyms: Rfpl3s
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75258
VEGA: 9
Homologene: 138467
Mup2
Name: major urinary protein 2
Synonyms: Mup-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17841
Homologene: 74304
Or10b1
Name: olfactory receptor family 10 subfamily B member 1
Synonyms: GA_x6K02T2QGN0-3289955-3289014, MOR267-9, Olfr1358
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258224
Homologene: 106627
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 13,701,363 bp (GRCm38)
  • G to C, chromosome 1 at 34,199,351 bp (GRCm38)
  • T to C, chromosome 1 at 36,221,225 bp (GRCm38)
  • C to T, chromosome 1 at 75,186,442 bp (GRCm38)
  • G to T, chromosome 1 at 90,777,527 bp (GRCm38)
  • G to A, chromosome 1 at 97,745,196 bp (GRCm38)
  • T to C, chromosome 1 at 140,102,411 bp (GRCm38)
  • C to G, chromosome 1 at 167,350,350 bp (GRCm38)
  • G to A, chromosome 1 at 171,886,427 bp (GRCm38)
  • A to C, chromosome 2 at 19,248,615 bp (GRCm38)
  • A to T, chromosome 2 at 25,574,738 bp (GRCm38)
  • A to G, chromosome 2 at 126,720,153 bp (GRCm38)
  • T to A, chromosome 2 at 181,347,067 bp (GRCm38)
  • T to A, chromosome 3 at 64,105,253 bp (GRCm38)
  • A to G, chromosome 3 at 107,104,952 bp (GRCm38)
  • T to A, chromosome 3 at 157,910,938 bp (GRCm38)
  • A to G, chromosome 4 at 32,645,873 bp (GRCm38)
  • G to A, chromosome 4 at 59,207,843 bp (GRCm38)
  • A to G, chromosome 4 at 60,139,740 bp (GRCm38)
  • A to T, chromosome 4 at 83,005,846 bp (GRCm38)
  • T to C, chromosome 4 at 113,490,651 bp (GRCm38)
  • G to A, chromosome 4 at 115,923,687 bp (GRCm38)
  • C to T, chromosome 4 at 150,236,751 bp (GRCm38)
  • T to C, chromosome 5 at 8,111,974 bp (GRCm38)
  • T to A, chromosome 5 at 32,937,698 bp (GRCm38)
  • G to T, chromosome 5 at 135,431,717 bp (GRCm38)
  • T to C, chromosome 5 at 137,734,932 bp (GRCm38)
  • A to G, chromosome 6 at 36,524,020 bp (GRCm38)
  • T to C, chromosome 6 at 67,267,041 bp (GRCm38)
  • C to T, chromosome 6 at 92,242,958 bp (GRCm38)
  • T to C, chromosome 7 at 26,814,635 bp (GRCm38)
  • T to C, chromosome 7 at 44,516,906 bp (GRCm38)
  • G to A, chromosome 7 at 139,921,476 bp (GRCm38)
  • G to A, chromosome 7 at 143,569,448 bp (GRCm38)
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp (GRCm38)
  • G to T, chromosome 8 at 104,963,991 bp (GRCm38)
  • G to T, chromosome 8 at 109,993,915 bp (GRCm38)
  • C to A, chromosome 9 at 56,010,492 bp (GRCm38)
  • G to T, chromosome 10 at 7,702,917 bp (GRCm38)
  • A to G, chromosome 10 at 23,864,600 bp (GRCm38)
  • A to T, chromosome 10 at 40,002,684 bp (GRCm38)
  • G to A, chromosome 10 at 60,772,249 bp (GRCm38)
  • G to A, chromosome 10 at 78,519,775 bp (GRCm38)
  • A to G, chromosome 11 at 71,123,108 bp (GRCm38)
  • C to T, chromosome 13 at 116,893,026 bp (GRCm38)
  • G to T, chromosome 14 at 28,080,157 bp (GRCm38)
  • A to G, chromosome 14 at 54,960,314 bp (GRCm38)
  • T to A, chromosome 14 at 68,637,494 bp (GRCm38)
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
  • G to A, chromosome 16 at 58,638,521 bp (GRCm38)
  • A to G, chromosome 17 at 25,311,241 bp (GRCm38)
  • A to T, chromosome 17 at 25,750,757 bp (GRCm38)
  • A to G, chromosome 17 at 81,649,069 bp (GRCm38)
  • G to A, chromosome 18 at 36,683,058 bp (GRCm38)
  • G to A, chromosome 18 at 67,519,392 bp (GRCm38)
  • T to C, chromosome 19 at 6,855,845 bp (GRCm38)
  • A to G, chromosome 19 at 7,603,991 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9441 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069245-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.