Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9446Btlr/Mmmh
Stock Number:
069249-MU
Citation ID:
RRID:MMRRC_069249-MU
Other Names:
R9446 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Adck2
Name: aarF domain containing kinase 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57869
Homologene: 49103
Ghitm
Name: growth hormone inducible transmembrane protein
Synonyms: PTD010, 1010001P14Rik, C77840, Tmbim5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66092
VEGA: 14
Homologene: 8667
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, D17Rp17, RP17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 38,535,256 bp (GRCm38)
  • C to A, chromosome 1 at 74,803,569 bp (GRCm38)
  • A to G, chromosome 1 at 136,117,624 bp (GRCm38)
  • T to A, chromosome 2 at 25,563,633 bp (GRCm38)
  • A to T, chromosome 2 at 87,809,855 bp (GRCm38)
  • T to G, chromosome 2 at 121,146,049 bp (GRCm38)
  • T to A, chromosome 2 at 126,830,265 bp (GRCm38)
  • G to A, chromosome 2 at 132,808,854 bp (GRCm38)
  • A to T, chromosome 2 at 177,475,271 bp (GRCm38)
  • C to T, chromosome 3 at 144,932,373 bp (GRCm38)
  • G to T, chromosome 5 at 30,196,959 bp (GRCm38)
  • A to G, chromosome 5 at 34,761,928 bp (GRCm38)
  • T to A, chromosome 5 at 76,248,441 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • T to A, chromosome 5 at 118,738,502 bp (GRCm38)
  • A to G, chromosome 5 at 120,916,884 bp (GRCm38)
  • A to T, chromosome 5 at 124,746,613 bp (GRCm38)
  • T to C, chromosome 5 at 137,871,167 bp (GRCm38)
  • A to G, chromosome 6 at 30,090,020 bp (GRCm38)
  • G to T, chromosome 6 at 39,574,287 bp (GRCm38)
  • T to A, chromosome 7 at 18,654,940 bp (GRCm38)
  • T to A, chromosome 7 at 121,076,308 bp (GRCm38)
  • GGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGGGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCAGGTTGGGGGCTCTGCACACAGCTTTGGAGGTGTACACACCGGGGTTGGGGCCTCTGCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,041,810 bp (GRCm38)
  • G to A, chromosome 9 at 21,635,859 bp (GRCm38)
  • A to T, chromosome 9 at 39,796,046 bp (GRCm38)
  • T to G, chromosome 11 at 67,364,499 bp (GRCm38)
  • T to A, chromosome 11 at 73,887,704 bp (GRCm38)
  • T to C, chromosome 11 at 93,943,682 bp (GRCm38)
  • A to G, chromosome 12 at 55,708,023 bp (GRCm38)
  • T to C, chromosome 12 at 108,515,206 bp (GRCm38)
  • C to G, chromosome 12 at 109,590,170 bp (GRCm38)
  • T to C, chromosome 12 at 114,583,768 bp (GRCm38)
  • T to C, chromosome 14 at 21,783,701 bp (GRCm38)
  • T to C, chromosome 14 at 30,784,740 bp (GRCm38)
  • A to G, chromosome 14 at 37,131,649 bp (GRCm38)
  • A to G, chromosome 14 at 50,238,517 bp (GRCm38)
  • A to T, chromosome 14 at 51,635,605 bp (GRCm38)
  • G to A, chromosome 14 at 64,747,021 bp (GRCm38)
  • T to C, chromosome 14 at 72,480,517 bp (GRCm38)
  • T to C, chromosome 15 at 102,551,488 bp (GRCm38)
  • G to A, chromosome 17 at 12,232,488 bp (GRCm38)
  • A to G, chromosome 17 at 74,618,496 bp (GRCm38)
  • T to A, chromosome 18 at 61,285,996 bp (GRCm38)
  • T to C, chromosome 19 at 18,838,098 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9446 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069249-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.