Strain Name:
C57BL/6J-MtgxR9448Btlr/Mmmh
Stock Number:
069251-MU
Citation ID:
RRID:MMRRC_069251-MU
Other Names:
R9448 (G1)
Major Collection:

Strain Information

Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: FAK, Fadk, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Plcb4
Name: phospholipase C, beta 4
Synonyms: A930039J07Rik, C230058B11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: WSTF, Wbscr9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Cep290
Name: centrosomal protein 290
Synonyms: Kiaa, b2b1752Clo, Nphp6, b2b1454Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Pcnt
Name: pericentrin (kendrin)
Synonyms: m239Asp, Pcnt2, m275Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Pip5k1c
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms: PIP5KIgamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18717
HGNC: HGNC:8996
Homologene: 69032
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, p325, C030033M12Rik, Hbxap, XAP8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212153
Homologene: 19484
Ptpn6
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: hcp, SHP-1, Hcph, Ptp1C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15170
HGNC: HGNC:9658
Homologene: 56589
Atp6v1a
Name: ATPase, H+ transporting, lysosomal V1 subunit A
Synonyms: VA68, lysosomal 70kDa, VPP2, Atp6a1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11964
HGNC: HGNC:851
Homologene: 123934
Phldb1
Name: pleckstrin homology like domain, family B, member 1
Synonyms: D330037A14Rik, LL5A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102693
Homologene: 15903
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: E130018M02Rik, mGluR7, Gpr1g, mGlu7a receptor, 6330570A01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Adcy1
Name: adenylate cyclase 1
Synonyms: D11Bwg1392e, I-AC, AC1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Flii
Name: flightless I actin binding protein
Synonyms: 3632430F08Rik, Fliih
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14248
HGNC: HGNC:3750
Homologene: 11092
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Prpf39
Name: pre-mRNA processing factor 39
Synonyms: Srcs1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328110
Homologene: 32377
Ms4a4c
Name: membrane-spanning 4-domains, subfamily A, member 4C
Synonyms: 5830413L19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 64380
Homologene: 113790
Knstrn
Name: kinetochore-localized astrin/SPAG5 binding
Synonyms: D2Ertd750e, 1700025D04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51944
Homologene: 12198
Dmrt1
Name: doublesex and mab-3 related transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 50796
HGNC: HGNC:2934
Homologene: 9280
Psmc6
Name: proteasome (prosome, macropain) 26S subunit, ATPase, 6
Synonyms: 2300001E01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67089
VEGA: 14
HGNC: HGNC:9553
Homologene: 100630
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: A230048G03Rik, 2010013B10Rik, D330050P16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Ehbp1
Name: EH domain binding protein 1
Synonyms: KIAA0903-like, Flj21950
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Mep1b
Name: meprin 1 beta
Synonyms: meprin beta, Mep-1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17288
VEGA: 18
HGNC: HGNC:7020
Homologene: 48382
Tbx19
Name: T-box 19
Synonyms: D1Ertd754e, Tpit
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 83993
Homologene: 3779
Fsd1l
Name: fibronectin type III and SPRY domain containing 1-like
Synonyms: Fsd1nl, Csdufd1, A230072O16Rik, Ccdc10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319636
Homologene: 45825
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: 9430031G15Rik, b2b1000Clo, LTBP-1, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Galnt18
Name: polypeptide N-acetylgalactosaminyltransferase 18
Synonyms: Galntl4, 2900011G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233733
Homologene: 18347
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5, Nav1.5c, SkM2, mH1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210510
Homologene: 19364
Tmem62
Name: transmembrane protein 62
Synonyms: B830009D23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 96957
Homologene: 11801
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Zdhhc8
Name: zinc finger, DHHC domain containing 8
Synonyms: D16H22S1738E, Op53c05, E330009O14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27801
VEGA: 16
Homologene: 8363
Tulp4
Name: TUB like protein 4
Synonyms: 2210038L17Rik, 1110057P05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212326
Homologene: 27540
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Mep1a
Name: meprin 1 alpha
Synonyms: Mep-1, Mep-1a, Mep1, meprin alpha, meprin A alpha-subunit
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17287
HGNC: HGNC:7015
Homologene: 31323
Kdr
Name: kinase insert domain protein receptor
Synonyms: Flk1, VEGFR2, Flk-1, VEGFR-2, vascular endothelial growth factor receptor- 2, orv, VEGF receptor-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Or5w13
Name: olfactory receptor family 5 subfamily W member 13
Synonyms: Olfr1136, GA_x6K02T2Q125-49193051-49192119, MOR177-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258653
Homologene: 74193
Tnfsf15
Name: tumor necrosis factor (ligand) superfamily, member 15
Synonyms: VEGI, TL1, TL1A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 326623
Homologene: 3755
Inhca
Name: inhibitor of carbonic anhydrase
Synonyms: mICA, 1300017J02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71775
Homologene: 826
Spata32
Name: spermatogenesis associated 32
Synonyms: 4933400C05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 328019
Homologene: 17554
Spata31f1a
Name: spermatogenesis associated 31 subfamily F member 1A
Synonyms: Gm12429, Fam205a1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433698
Homologene: 79022
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: 4930406H16Rik, Nalp-epsilon, Nalp4e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Exo5
Name: exonuclease 5
Synonyms: Dem1, 3110037I16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73172
Homologene: 41497
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Zfy2
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22768
Homologene: 56456
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Zscan26
Name: zinc finger and SCAN domain containing 26
Synonyms: Zfp187
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432731
Homologene: 43739
Dph7
Name: diphthamine biosynethesis 7
Synonyms: Wdr85, 2810443J12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67228
Homologene: 5432
Or1l4
Name: olfactory receptor family 1 subfamily L member 4
Synonyms: MOR138-1, GA_x6K02T2NLDC-33885305-33886243, Olfr365
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258656
Homologene: 74156
Pdzk1
Name: PDZ domain containing 1
Synonyms: 4921513F16Rik, Nherf3, mPDZK1, 1700023D20Rik, 2610507N21Rik, D3Ertd537e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59020
Homologene: 1964
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
2200002D01Rik
Name: RIKEN cDNA 2200002D01 gene
Synonyms: HAI-2 related small protein, H2RSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72275
Homologene: 137385
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Diras2
Name: DIRAS family, GTP-binding RAS-like 2
Synonyms: 2900052J15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68203
VEGA: 13
Homologene: 56777
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Gm5478
Name: predicted pseudogene 5478
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432987
VEGA: 15
Igkv12-98
Name: immunoglobulin kappa variable 12-98
Synonyms: Gm16636
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435900
Spata31f1e
Name: spermatogenesis associated 31 subfamily F member 1E
Synonyms: Gm12394
Type: Gene
Species: Mouse
Chromosome: 4
Foxl1
Name: forkhead box L1
Synonyms: fkh6, Fkh6, FREAC7, fkh-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14241
HGNC: HGNC:3817
Homologene: 48335
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 40,327,444 bp (GRCm38)
  • G to T, chromosome 1 at 75,186,205 bp (GRCm38)
  • T to C, chromosome 1 at 165,153,521 bp (GRCm38)
  • T to C, chromosome 1 at 191,012,209 bp (GRCm38)
  • A to T, chromosome 2 at 24,971,940 bp (GRCm38)
  • A to G, chromosome 2 at 37,201,209 bp (GRCm38)
  • A to G, chromosome 2 at 37,787,761 bp (GRCm38)
  • A to T, chromosome 2 at 87,693,480 bp (GRCm38)
  • T to C, chromosome 2 at 112,349,359 bp (GRCm38)
  • T to C, chromosome 2 at 118,814,494 bp (GRCm38)
  • A to C, chromosome 2 at 120,977,730 bp (GRCm38)
  • G to A, chromosome 2 at 135,910,125 bp (GRCm38)
  • G to C, chromosome 2 at 153,804,941 bp (GRCm38)
  • T to G, chromosome 2 at 167,046,924 bp (GRCm38)
  • A to T, chromosome 3 at 96,854,606 bp (GRCm38)
  • T to C, chromosome 4 at 42,793,440 bp (GRCm38)
  • A to T, chromosome 4 at 42,850,250 bp (GRCm38)
  • G to T, chromosome 4 at 53,694,826 bp (GRCm38)
  • A to T, chromosome 4 at 63,745,068 bp (GRCm38)
  • A to G, chromosome 4 at 120,921,691 bp (GRCm38)
  • C to A, chromosome 4 at 156,236,324 bp (GRCm38)
  • T to C, chromosome 5 at 75,941,909 bp (GRCm38)
  • T to C, chromosome 5 at 135,210,802 bp (GRCm38)
  • T to C, chromosome 6 at 40,887,226 bp (GRCm38)
  • T to C, chromosome 6 at 68,571,172 bp (GRCm38)
  • T to C, chromosome 6 at 83,032,991 bp (GRCm38)
  • A to T, chromosome 6 at 111,358,232 bp (GRCm38)
  • G to A, chromosome 6 at 124,732,808 bp (GRCm38)
  • A to T, chromosome 7 at 23,301,531 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to T, chromosome 7 at 85,872,819 bp (GRCm38)
  • A to T, chromosome 7 at 87,395,793 bp (GRCm38)
  • G to GCCGGCGGCT, chromosome 7 at 97,579,909 bp (GRCm38)
  • A to T, chromosome 7 at 111,554,442 bp (GRCm38)
  • T to A, chromosome 8 at 45,339,374 bp (GRCm38)
  • T to C, chromosome 8 at 121,128,869 bp (GRCm38)
  • G to T, chromosome 9 at 44,711,249 bp (GRCm38)
  • G to T, chromosome 9 at 103,272,582 bp (GRCm38)
  • A to G, chromosome 9 at 119,552,061 bp (GRCm38)
  • T to C, chromosome 10 at 76,420,526 bp (GRCm38)
  • A to G, chromosome 10 at 81,305,811 bp (GRCm38)
  • T to G, chromosome 10 at 100,559,684 bp (GRCm38)
  • T to A, chromosome 10 at 116,313,914 bp (GRCm38)
  • T to C, chromosome 11 at 7,149,575 bp (GRCm38)
  • T to C, chromosome 11 at 22,137,881 bp (GRCm38)
  • T to C, chromosome 11 at 60,715,567 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • C to T, chromosome 11 at 103,208,822 bp (GRCm38)
  • T to C, chromosome 11 at 116,447,265 bp (GRCm38)
  • T to A, chromosome 12 at 65,061,260 bp (GRCm38)
  • A to G, chromosome 12 at 83,842,216 bp (GRCm38)
  • A to G, chromosome 13 at 21,448,261 bp (GRCm38)
  • T to A, chromosome 13 at 52,508,086 bp (GRCm38)
  • T to A, chromosome 13 at 116,902,824 bp (GRCm38)
  • T to C, chromosome 14 at 45,331,026 bp (GRCm38)
  • T to C, chromosome 15 at 47,596,919 bp (GRCm38)
  • T to A, chromosome 15 at 73,343,192 bp (GRCm38)
  • T to C, chromosome 15 at 101,645,227 bp (GRCm38)
  • C to A, chromosome 16 at 18,221,694 bp (GRCm38)
  • T to A, chromosome 16 at 43,938,975 bp (GRCm38)
  • T to A, chromosome 16 at 44,111,509 bp (GRCm38)
  • T to C, chromosome 17 at 6,198,673 bp (GRCm38)
  • T to C, chromosome 17 at 43,494,978 bp (GRCm38)
  • T to C, chromosome 17 at 43,625,676 bp (GRCm38)
  • C to T, chromosome 17 at 75,359,460 bp (GRCm38)
  • T to C, chromosome 17 at 78,760,586 bp (GRCm38)
  • A to G, chromosome 18 at 21,084,142 bp (GRCm38)
  • G to A, chromosome 18 at 38,197,439 bp (GRCm38)
  • T to A, chromosome 19 at 11,414,953 bp (GRCm38)
  • T to C, chromosome 19 at 25,545,891 bp (GRCm38)
  • A to G, chromosome Y at 2,109,904 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9448 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069251-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.