MMRRC:069251-MU

A to G, chromosome 1 at 40,327,444 bp (GRCm38)
G to T, chromosome 1 at 75,186,205 bp (GRCm38)
T to C, chromosome 1 at 165,153,521 bp (GRCm38)
T to C, chromosome 1 at 191,012,209 bp (GRCm38)
A to T, chromosome 2 at 24,971,940 bp (GRCm38)
A to G, chromosome 2 at 37,201,209 bp (GRCm38)
A to G, chromosome 2 at 37,787,761 bp (GRCm38)
A to T, chromosome 2 at 87,693,480 bp (GRCm38)
T to C, chromosome 2 at 112,349,359 bp (GRCm38)
T to C, chromosome 2 at 118,814,494 bp (GRCm38)
A to C, chromosome 2 at 120,977,730 bp (GRCm38)
G to A, chromosome 2 at 135,910,125 bp (GRCm38)
G to C, chromosome 2 at 153,804,941 bp (GRCm38)
T to G, chromosome 2 at 167,046,924 bp (GRCm38)
A to T, chromosome 3 at 96,854,606 bp (GRCm38)
T to C, chromosome 4 at 42,793,440 bp (GRCm38)
A to T, chromosome 4 at 42,850,250 bp (GRCm38)
G to T, chromosome 4 at 53,694,826 bp (GRCm38)
A to T, chromosome 4 at 63,745,068 bp (GRCm38)
A to G, chromosome 4 at 120,921,691 bp (GRCm38)
C to A, chromosome 4 at 156,236,324 bp (GRCm38)
T to C, chromosome 5 at 75,941,909 bp (GRCm38)
T to C, chromosome 5 at 135,210,802 bp (GRCm38)
T to C, chromosome 6 at 40,887,226 bp (GRCm38)
T to C, chromosome 6 at 68,571,172 bp (GRCm38)
T to C, chromosome 6 at 83,032,991 bp (GRCm38)
A to T, chromosome 6 at 111,358,232 bp (GRCm38)
G to A, chromosome 6 at 124,732,808 bp (GRCm38)
A to T, chromosome 7 at 23,301,531 bp (GRCm38)
CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
A to T, chromosome 7 at 85,872,819 bp (GRCm38)
A to T, chromosome 7 at 87,395,793 bp (GRCm38)
G to GCCGGCGGCT, chromosome 7 at 97,579,909 bp (GRCm38)
A to T, chromosome 7 at 111,554,442 bp (GRCm38)
T to A, chromosome 8 at 45,339,374 bp (GRCm38)
T to C, chromosome 8 at 121,128,869 bp (GRCm38)
G to T, chromosome 9 at 44,711,249 bp (GRCm38)
G to T, chromosome 9 at 103,272,582 bp (GRCm38)
A to G, chromosome 9 at 119,552,061 bp (GRCm38)
T to C, chromosome 10 at 76,420,526 bp (GRCm38)
A to G, chromosome 10 at 81,305,811 bp (GRCm38)
T to G, chromosome 10 at 100,559,684 bp (GRCm38)
T to A, chromosome 10 at 116,313,914 bp (GRCm38)
T to C, chromosome 11 at 7,149,575 bp (GRCm38)
T to C, chromosome 11 at 22,137,881 bp (GRCm38)
T to C, chromosome 11 at 60,715,567 bp (GRCm38)
TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
C to T, chromosome 11 at 103,208,822 bp (GRCm38)
T to C, chromosome 11 at 116,447,265 bp (GRCm38)
T to A, chromosome 12 at 65,061,260 bp (GRCm38)
A to G, chromosome 12 at 83,842,216 bp (GRCm38)
A to G, chromosome 13 at 21,448,261 bp (GRCm38)
T to A, chromosome 13 at 52,508,086 bp (GRCm38)
T to A, chromosome 13 at 116,902,824 bp (GRCm38)
T to C, chromosome 14 at 45,331,026 bp (GRCm38)
T to C, chromosome 15 at 47,596,919 bp (GRCm38)
T to A, chromosome 15 at 73,343,192 bp (GRCm38)
T to C, chromosome 15 at 101,645,227 bp (GRCm38)
C to A, chromosome 16 at 18,221,694 bp (GRCm38)
T to A, chromosome 16 at 43,938,975 bp (GRCm38)
T to A, chromosome 16 at 44,111,509 bp (GRCm38)
T to C, chromosome 17 at 6,198,673 bp (GRCm38)
T to C, chromosome 17 at 43,494,978 bp (GRCm38)
T to C, chromosome 17 at 43,625,676 bp (GRCm38)
C to T, chromosome 17 at 75,359,460 bp (GRCm38)
T to C, chromosome 17 at 78,760,586 bp (GRCm38)
A to G, chromosome 18 at 21,084,142 bp (GRCm38)
G to A, chromosome 18 at 38,197,439 bp (GRCm38)
T to A, chromosome 19 at 11,414,953 bp (GRCm38)
T to C, chromosome 19 at 25,545,891 bp (GRCm38)
A to G, chromosome Y at 2,109,904 bp (GRCm38)

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R9448 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
069251-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All