Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9462Btlr/Mmmh
Stock Number:
069265-MU
Citation ID:
RRID:MMRRC_069265-MU
Other Names:
R9462 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Eef1e1
Name: eukaryotic translation elongation factor 1 epsilon 1
Synonyms: 1110003A02Rik, AIMP3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66143
VEGA: 13
HGNC: HGNC:3212
Homologene: 3161
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 12,859,235 bp (GRCm38)
  • T to C, chromosome 1 at 14,229,551 bp (GRCm38)
  • G to A, chromosome 1 at 63,058,234 bp (GRCm38)
  • A to C, chromosome 1 at 172,072,140 bp (GRCm38)
  • T to A, chromosome 1 at 184,919,671 bp (GRCm38)
  • C to T, chromosome 2 at 25,254,863 bp (GRCm38)
  • T to C, chromosome 2 at 73,273,899 bp (GRCm38)
  • A to G, chromosome 2 at 120,729,579 bp (GRCm38)
  • A to G, chromosome 2 at 131,074,484 bp (GRCm38)
  • T to G, chromosome 2 at 152,919,453 bp (GRCm38)
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp (GRCm38)
  • T to A, chromosome 2 at 181,825,936 bp (GRCm38)
  • T to C, chromosome 3 at 33,814,370 bp (GRCm38)
  • A to G, chromosome 4 at 47,033,142 bp (GRCm38)
  • G to A, chromosome 4 at 63,133,273 bp (GRCm38)
  • A to G, chromosome 4 at 96,762,838 bp (GRCm38)
  • G to A, chromosome 4 at 103,235,767 bp (GRCm38)
  • G to T, chromosome 4 at 123,322,648 bp (GRCm38)
  • G to T, chromosome 4 at 126,176,255 bp (GRCm38)
  • A to G, chromosome 4 at 141,104,005 bp (GRCm38)
  • A to T, chromosome 4 at 149,360,291 bp (GRCm38)
  • A to C, chromosome 4 at 154,858,082 bp (GRCm38)
  • A to G, chromosome 5 at 14,790,394 bp (GRCm38)
  • G to T, chromosome 5 at 16,822,215 bp (GRCm38)
  • G to A, chromosome 5 at 62,882,283 bp (GRCm38)
  • G to A, chromosome 5 at 65,790,555 bp (GRCm38)
  • A to G, chromosome 5 at 73,434,352 bp (GRCm38)
  • G to A, chromosome 5 at 89,046,272 bp (GRCm38)
  • A to T, chromosome 5 at 125,340,827 bp (GRCm38)
  • A to T, chromosome 5 at 139,544,016 bp (GRCm38)
  • C to A, chromosome 5 at 142,485,465 bp (GRCm38)
  • G to A, chromosome 6 at 41,968,171 bp (GRCm38)
  • T to C, chromosome 6 at 46,234,283 bp (GRCm38)
  • A to T, chromosome 6 at 120,294,477 bp (GRCm38)
  • A to G, chromosome 7 at 3,911,995 bp (GRCm38)
  • A to G, chromosome 7 at 4,758,331 bp (GRCm38)
  • A to T, chromosome 7 at 12,176,334 bp (GRCm38)
  • G to T, chromosome 7 at 45,651,068 bp (GRCm38)
  • T to C, chromosome 7 at 51,585,452 bp (GRCm38)
  • A to G, chromosome 7 at 119,952,300 bp (GRCm38)
  • G to T, chromosome 7 at 127,591,838 bp (GRCm38)
  • T to A, chromosome 7 at 141,861,479 bp (GRCm38)
  • A to T, chromosome 8 at 22,000,144 bp (GRCm38)
  • C to A, chromosome 8 at 94,672,127 bp (GRCm38)
  • A to G, chromosome 9 at 15,582,586 bp (GRCm38)
  • T to A, chromosome 9 at 42,337,280 bp (GRCm38)
  • C to G, chromosome 9 at 86,756,339 bp (GRCm38)
  • A to G, chromosome 9 at 123,779,535 bp (GRCm38)
  • T to C, chromosome 10 at 21,342,405 bp (GRCm38)
  • T to C, chromosome 10 at 79,888,049 bp (GRCm38)
  • T to G, chromosome 10 at 82,061,297 bp (GRCm38)
  • C to T, chromosome 10 at 84,528,060 bp (GRCm38)
  • T to C, chromosome 10 at 92,902,058 bp (GRCm38)
  • G to A, chromosome 11 at 50,923,696 bp (GRCm38)
  • A to G, chromosome 11 at 67,250,985 bp (GRCm38)
  • C to T, chromosome 11 at 72,037,427 bp (GRCm38)
  • A to T, chromosome 11 at 101,078,980 bp (GRCm38)
  • T to A, chromosome 11 at 103,227,534 bp (GRCm38)
  • T to A, chromosome 11 at 109,953,607 bp (GRCm38)
  • C to T, chromosome 11 at 113,869,918 bp (GRCm38)
  • C to A, chromosome 12 at 112,787,035 bp (GRCm38)
  • T to C, chromosome 13 at 9,877,401 bp (GRCm38)
  • A to G, chromosome 13 at 18,139,604 bp (GRCm38)
  • A to T, chromosome 13 at 21,674,845 bp (GRCm38)
  • A to G, chromosome 13 at 38,655,021 bp (GRCm38)
  • A to T, chromosome 13 at 59,782,143 bp (GRCm38)
  • A to G, chromosome 15 at 64,166,479 bp (GRCm38)
  • T to A, chromosome 15 at 98,313,305 bp (GRCm38)
  • T to A, chromosome 15 at 101,032,278 bp (GRCm38)
  • C to T, chromosome 17 at 14,669,981 bp (GRCm38)
  • C to A, chromosome 17 at 19,378,126 bp (GRCm38)
  • G to A, chromosome 17 at 34,587,693 bp (GRCm38)
  • A to G, chromosome 17 at 40,565,424 bp (GRCm38)
  • T to A, chromosome 18 at 36,940,493 bp (GRCm38)
  • T to G, chromosome 18 at 37,506,746 bp (GRCm38)
  • A to G, chromosome 19 at 4,601,942 bp (GRCm38)
  • A to T, chromosome 19 at 9,003,935 bp (GRCm38)
  • A to G, chromosome 19 at 37,693,186 bp (GRCm38)
  • A to G, chromosome 19 at 55,233,037 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9462 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069265-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.