Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9474Btlr/Mmmh
Stock Number:
069277-MU
Citation ID:
RRID:MMRRC_069277-MU
Other Names:
R9474 (G1)
Major Collection:

Strain Information

Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, D10Ertd739e, E2F7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Elovl5
Name: ELOVL fatty acid elongase 5
Synonyms: 1110059L23Rik, ELOVL family member 5, elongation of long chain fatty acids (yeast)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68801
Homologene: 41449
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70797
Homologene: 19076
Mbtd1
Name: mbt domain containing 1
Synonyms: hemp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103537
Homologene: 41185
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 4,092,615 bp (GRCm38)
  • A to G, chromosome 1 at 135,283,603 bp (GRCm38)
  • G to A, chromosome 1 at 150,630,720 bp (GRCm38)
  • T to C, chromosome 1 at 177,025,386 bp (GRCm38)
  • T to C, chromosome 1 at 182,892,100 bp (GRCm38)
  • C to A, chromosome 2 at 17,369,610 bp (GRCm38)
  • C to T, chromosome 2 at 24,094,638 bp (GRCm38)
  • C to A, chromosome 2 at 40,601,587 bp (GRCm38)
  • T to G, chromosome 2 at 64,938,400 bp (GRCm38)
  • A to G, chromosome 2 at 86,959,413 bp (GRCm38)
  • T to C, chromosome 2 at 87,896,349 bp (GRCm38)
  • A to C, chromosome 2 at 89,789,162 bp (GRCm38)
  • T to C, chromosome 2 at 118,120,037 bp (GRCm38)
  • A to T, chromosome 2 at 150,940,806 bp (GRCm38)
  • A to T, chromosome 3 at 117,323,217 bp (GRCm38)
  • T to A, chromosome 3 at 144,911,166 bp (GRCm38)
  • T to C, chromosome 3 at 158,135,391 bp (GRCm38)
  • T to A, chromosome 4 at 139,366,394 bp (GRCm38)
  • A to G, chromosome 5 at 3,755,617 bp (GRCm38)
  • T to C, chromosome 5 at 14,521,236 bp (GRCm38)
  • A to G, chromosome 5 at 20,195,021 bp (GRCm38)
  • A to T, chromosome 5 at 25,953,138 bp (GRCm38)
  • A to G, chromosome 5 at 33,898,751 bp (GRCm38)
  • G to A, chromosome 5 at 72,108,347 bp (GRCm38)
  • T to A, chromosome 5 at 96,739,265 bp (GRCm38)
  • G to A, chromosome 5 at 117,325,039 bp (GRCm38)
  • G to A, chromosome 5 at 120,899,254 bp (GRCm38)
  • A to G, chromosome 5 at 123,029,238 bp (GRCm38)
  • T to A, chromosome 6 at 40,455,110 bp (GRCm38)
  • G to A, chromosome 6 at 43,307,181 bp (GRCm38)
  • T to A, chromosome 6 at 82,728,914 bp (GRCm38)
  • G to A, chromosome 6 at 129,463,163 bp (GRCm38)
  • G to A, chromosome 7 at 6,065,627 bp (GRCm38)
  • A to G, chromosome 7 at 6,231,473 bp (GRCm38)
  • A to G, chromosome 7 at 6,502,151 bp (GRCm38)
  • A to G, chromosome 7 at 25,094,822 bp (GRCm38)
  • A to G, chromosome 7 at 35,204,064 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to T, chromosome 7 at 103,683,270 bp (GRCm38)
  • G to A, chromosome 7 at 131,074,257 bp (GRCm38)
  • T to C, chromosome 7 at 132,641,583 bp (GRCm38)
  • A to G, chromosome 8 at 10,031,648 bp (GRCm38)
  • A to T, chromosome 8 at 24,747,524 bp (GRCm38)
  • T to G, chromosome 8 at 57,777,325 bp (GRCm38)
  • T to C, chromosome 8 at 70,884,952 bp (GRCm38)
  • T to A, chromosome 8 at 112,733,471 bp (GRCm38)
  • T to C, chromosome 8 at 125,924,164 bp (GRCm38)
  • T to A, chromosome 8 at 126,429,040 bp (GRCm38)
  • T to C, chromosome 9 at 22,431,719 bp (GRCm38)
  • G to T, chromosome 9 at 44,348,993 bp (GRCm38)
  • T to A, chromosome 9 at 77,982,725 bp (GRCm38)
  • T to C, chromosome 9 at 78,406,386 bp (GRCm38)
  • C to T, chromosome 9 at 119,037,377 bp (GRCm38)
  • GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC to GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC, chromosome 10 at 76,150,404 bp (GRCm38)
  • T to C, chromosome 10 at 78,847,057 bp (GRCm38)
  • C to A, chromosome 10 at 79,067,731 bp (GRCm38)
  • C to T, chromosome 10 at 110,767,189 bp (GRCm38)
  • C to A, chromosome 10 at 110,779,057 bp (GRCm38)
  • C to A, chromosome 10 at 128,563,098 bp (GRCm38)
  • G to A, chromosome 11 at 67,364,886 bp (GRCm38)
  • A to G, chromosome 11 at 93,925,685 bp (GRCm38)
  • A to T, chromosome 12 at 4,866,820 bp (GRCm38)
  • T to A, chromosome 12 at 8,538,794 bp (GRCm38)
  • A to G, chromosome 13 at 9,494,927 bp (GRCm38)
  • A to C, chromosome 13 at 16,017,678 bp (GRCm38)
  • A to G, chromosome 13 at 49,187,600 bp (GRCm38)
  • G to A, chromosome 13 at 58,019,459 bp (GRCm38)
  • A to C, chromosome 13 at 96,659,895 bp (GRCm38)
  • T to A, chromosome 15 at 41,103,471 bp (GRCm38)
  • T to C, chromosome 16 at 32,794,083 bp (GRCm38)
  • A to G, chromosome 17 at 12,403,137 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • A to G, chromosome 17 at 80,150,132 bp (GRCm38)
  • T to A, chromosome 18 at 80,233,424 bp (GRCm38)
  • G to A, chromosome 19 at 38,777,893 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9474 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069277-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.