Strain Name:
C57BL/6J-MtgxR9474Btlr/Mmmh
Stock Number:
069277-MU
Citation ID:
RRID:MMRRC_069277-MU
Other Names:
R9474 (G1)
Major Collection:

Strain Information

Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
E2f7
Name: E2F transcription factor 7
Synonyms: A630014C11Rik, E2F7, D10Ertd739e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52679
Homologene: 18685
Elovl5
Name: ELOVL fatty acid elongase 5
Synonyms: 1110059L23Rik, ELOVL family member 5, elongation of long chain fatty acids (yeast)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68801
Homologene: 41449
Ankib1
Name: ankyrin repeat and IBR domain containing 1
Synonyms: 2310061P20Rik, 4631416I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70797
Homologene: 19076
Mbtd1
Name: mbt domain containing 1
Synonyms: hemp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103537
Homologene: 41185
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Thbs1
Name: thrombospondin 1
Synonyms: TSP1, TSP-1, Thbs-1, tbsp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Orai1
Name: ORAI calcium release-activated calcium modulator 1
Synonyms: D730049H07Rik, Tmem142a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109305
Homologene: 13117
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Vps11
Name: VPS11, CORVET/HOPS core subunit
Synonyms: 1200011A11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71732
VEGA: 9
Homologene: 6673
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Clec7a
Name: C-type lectin domain family 7, member a
Synonyms: dectin-1, BGR, beta-GR, beta-glucan receptor, Clecsf12
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56644
Homologene: 49606
Muc20
Name: mucin 20
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224116
Homologene: 17135
Pa2g4
Name: proliferation-associated 2G4
Synonyms: Plfap, Ebp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18813
HGNC: HGNC:8550
Homologene: 4513
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
2610008E11Rik
Name: RIKEN cDNA 2610008E11 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72128
Homologene: 86705
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Susd4
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96935
Homologene: 23062
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24099
Homologene: 48443
Nobox
Name: NOBOX oogenesis homeobox
Synonyms: Og2x
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18291
Homologene: 51066
Zfpm2
Name: zinc finger protein, multitype 2
Synonyms: FOG-2, FOG2, B330005D23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22762
VEGA: 15
Homologene: 8008
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212728
Homologene: 38082
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215615
Homologene: 10628
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Ctdspl
Name: CTD small phosphatase like
Synonyms: SCP3, HYA22, 2810418J22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69274
Homologene: 48881
Inhba
Name: inhibin beta-A
Synonyms: activin beta-A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16323
VEGA: 13
HGNC: HGNC:6066
Homologene: 1653
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64452
VEGA: 10
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Grb14
Name: growth factor receptor bound protein 14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50915
HGNC: HGNC:4565
Homologene: 3303
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Vsig10
Name: V-set and immunoglobulin domain containing 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231668
Homologene: 10414
Lhpp
Name: phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms: 2310007H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76429
Homologene: 41469
Gabrb1
Name: gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms: Gabrb-1, B230208N19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14400
HGNC: HGNC:4081
Homologene: 20221
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Or5w20
Name: olfactory receptor family 5 subfamily W member 20
Synonyms: GA_x6K02T2Q125-49395950-49396882, MOR177-7, Olfr1153
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258633
Homologene: 27230
Mfsd2b
Name: MFSD2 lysolipid transporter B, sphingolipid
Synonyms: major facilitator superfamily domain containing 2B, Gm1964
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432628
Homologene: 47753
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3, Olfr1099
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Slc5a5
Name: solute carrier family 5 (sodium iodide symporter), member 5
Synonyms: NIS
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114479
Homologene: 37311
Map3k21
Name: mitogen-activated protein kinase kinase kinase 21
Synonyms: BC021891
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234878
Homologene: 32778
Tbpl2
Name: TATA box binding protein like 2
Synonyms: LOC227606, Trf3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227606
Homologene: 133152
Nlrp4c
Name: NLR family, pyrin domain containing 4C
Synonyms: Nalp-alpha, Rnh2, Nalp4c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83564
Homologene: 75315
Pou2f2
Name: POU domain, class 2, transcription factor 2
Synonyms: Oct2b, Oct2a, Otf-2, Oct-2, Otf2, Oct2d, Oct2c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18987
HGNC: HGNC:9213
Homologene: 55674
Plppr4
Name: phospholipid phosphatase related 4
Synonyms: D3Bwg0562e, Lppr4, PRG-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229791
Homologene: 8895
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Slc7a15
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 15
Synonyms: 2010001P20Rik, Arpat, 9030221C07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328059
Homologene: 77627
Zscan5b
Name: zinc finger and SCAN domain containing 5B
Synonyms: Zfg1, Zfp371
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170734
Homologene: 129555
Ddx43
Name: DEAD box helicase 43
Synonyms: ENSMUSG00000070291, OTTMUSG00000019690, DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100048658
Homologene: 56814
Oas1a
Name: 2'-5' oligoadenylate synthetase 1A
Synonyms: L3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246730
HGNC: HGNC:8086
Homologene: 1903
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270049
Homologene: 65137
Klhl3
Name: kelch-like 3
Synonyms: 7530408C15Rik, EG627648
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100503085
HGNC: HGNC:6354
Homologene: 79542
Or52z15
Name: olfactory receptor family 52 subfamily Z member 15
Synonyms: GA_x6K02T2PBJ9-6416276-6417237, MOR31-15P, Olfr625
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258169
Or4a81
Name: olfactory receptor family 4 subfamily A member 81
Synonyms: GA_x6K02T2Q125-51230155-51229211, MOR231-13, Olfr1254
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258468
Homologene: 103784
Matcap2
Name: microtubule associated tyrosine carboxypeptidase 2
Synonyms: 9530077C05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68283
VEGA: 9
Homologene: 19280
Hsbp1l1
Name: heat shock factor binding protein 1-like 1
Synonyms: 1810005K13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66255
VEGA: 18
Homologene: 122116
Galm
Name: galactose mutarotase
Synonyms: aldose 1-epimerase, A530057M15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319625
Homologene: 71795
Or7c70
Name: olfactory receptor family 7 subfamily C member 70
Synonyms: GA_x6K02T2QGN0-2962025-2962987, MOR142-2_p, MOR142-1, Olfr1356
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258305
Homologene: 71958
Or6z1
Name: olfactory receptor family 6 subfamily Z member 1
Synonyms: GA_x6K02T2QGBW-3232059-3231121, MOR103-9, Olfr1348
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258915
Homologene: 17435
Ninj1
Name: ninjurin 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18081
HGNC: HGNC:7824
Homologene: 88815
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Speer4a3
Name: spermatogenesis associated glutamate (E)-rich protein 4A3
Synonyms: Gm21671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862359
Homologene: 69402
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 4,092,615 bp (GRCm38)
  • A to G, chromosome 1 at 135,283,603 bp (GRCm38)
  • G to A, chromosome 1 at 150,630,720 bp (GRCm38)
  • T to C, chromosome 1 at 177,025,386 bp (GRCm38)
  • T to C, chromosome 1 at 182,892,100 bp (GRCm38)
  • C to A, chromosome 2 at 17,369,610 bp (GRCm38)
  • C to T, chromosome 2 at 24,094,638 bp (GRCm38)
  • C to A, chromosome 2 at 40,601,587 bp (GRCm38)
  • T to G, chromosome 2 at 64,938,400 bp (GRCm38)
  • A to G, chromosome 2 at 86,959,413 bp (GRCm38)
  • T to C, chromosome 2 at 87,896,349 bp (GRCm38)
  • A to C, chromosome 2 at 89,789,162 bp (GRCm38)
  • T to C, chromosome 2 at 118,120,037 bp (GRCm38)
  • A to T, chromosome 2 at 150,940,806 bp (GRCm38)
  • A to T, chromosome 3 at 117,323,217 bp (GRCm38)
  • T to A, chromosome 3 at 144,911,166 bp (GRCm38)
  • T to C, chromosome 3 at 158,135,391 bp (GRCm38)
  • T to A, chromosome 4 at 139,366,394 bp (GRCm38)
  • A to G, chromosome 5 at 3,755,617 bp (GRCm38)
  • T to C, chromosome 5 at 14,521,236 bp (GRCm38)
  • A to G, chromosome 5 at 20,195,021 bp (GRCm38)
  • A to T, chromosome 5 at 25,953,138 bp (GRCm38)
  • A to G, chromosome 5 at 33,898,751 bp (GRCm38)
  • G to A, chromosome 5 at 72,108,347 bp (GRCm38)
  • T to A, chromosome 5 at 96,739,265 bp (GRCm38)
  • G to A, chromosome 5 at 117,325,039 bp (GRCm38)
  • G to A, chromosome 5 at 120,899,254 bp (GRCm38)
  • A to G, chromosome 5 at 123,029,238 bp (GRCm38)
  • T to A, chromosome 6 at 40,455,110 bp (GRCm38)
  • G to A, chromosome 6 at 43,307,181 bp (GRCm38)
  • T to A, chromosome 6 at 82,728,914 bp (GRCm38)
  • G to A, chromosome 6 at 129,463,163 bp (GRCm38)
  • G to A, chromosome 7 at 6,065,627 bp (GRCm38)
  • A to G, chromosome 7 at 6,231,473 bp (GRCm38)
  • A to G, chromosome 7 at 6,502,151 bp (GRCm38)
  • A to G, chromosome 7 at 25,094,822 bp (GRCm38)
  • A to G, chromosome 7 at 35,204,064 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to T, chromosome 7 at 103,683,270 bp (GRCm38)
  • G to A, chromosome 7 at 131,074,257 bp (GRCm38)
  • T to C, chromosome 7 at 132,641,583 bp (GRCm38)
  • A to G, chromosome 8 at 10,031,648 bp (GRCm38)
  • A to T, chromosome 8 at 24,747,524 bp (GRCm38)
  • T to G, chromosome 8 at 57,777,325 bp (GRCm38)
  • T to C, chromosome 8 at 70,884,952 bp (GRCm38)
  • T to A, chromosome 8 at 112,733,471 bp (GRCm38)
  • T to C, chromosome 8 at 125,924,164 bp (GRCm38)
  • T to A, chromosome 8 at 126,429,040 bp (GRCm38)
  • T to C, chromosome 9 at 22,431,719 bp (GRCm38)
  • G to T, chromosome 9 at 44,348,993 bp (GRCm38)
  • T to A, chromosome 9 at 77,982,725 bp (GRCm38)
  • T to C, chromosome 9 at 78,406,386 bp (GRCm38)
  • C to T, chromosome 9 at 119,037,377 bp (GRCm38)
  • GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC to GCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGC, chromosome 10 at 76,150,404 bp (GRCm38)
  • T to C, chromosome 10 at 78,847,057 bp (GRCm38)
  • C to A, chromosome 10 at 79,067,731 bp (GRCm38)
  • C to T, chromosome 10 at 110,767,189 bp (GRCm38)
  • C to A, chromosome 10 at 110,779,057 bp (GRCm38)
  • C to A, chromosome 10 at 128,563,098 bp (GRCm38)
  • G to A, chromosome 11 at 67,364,886 bp (GRCm38)
  • A to G, chromosome 11 at 93,925,685 bp (GRCm38)
  • A to T, chromosome 12 at 4,866,820 bp (GRCm38)
  • T to A, chromosome 12 at 8,538,794 bp (GRCm38)
  • A to G, chromosome 13 at 9,494,927 bp (GRCm38)
  • A to C, chromosome 13 at 16,017,678 bp (GRCm38)
  • A to G, chromosome 13 at 49,187,600 bp (GRCm38)
  • G to A, chromosome 13 at 58,019,459 bp (GRCm38)
  • A to C, chromosome 13 at 96,659,895 bp (GRCm38)
  • T to A, chromosome 15 at 41,103,471 bp (GRCm38)
  • T to C, chromosome 16 at 32,794,083 bp (GRCm38)
  • A to G, chromosome 17 at 12,403,137 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • A to G, chromosome 17 at 80,150,132 bp (GRCm38)
  • T to A, chromosome 18 at 80,233,424 bp (GRCm38)
  • G to A, chromosome 19 at 38,777,893 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9474 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069277-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.