Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9475Btlr/Mmmh
Stock Number:
069278-MU
Citation ID:
RRID:MMRRC_069278-MU
Other Names:
R9475 (G1)
Major Collection:

Strain Information

Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: Semaphorin K1, CDw108, Semal, 2900057C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Afg2a
Name: AFG2 AAA ATPase homolog A
Synonyms: 2510048F20Rik, Spaf, C78064, Spata5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57815
Homologene: 56920
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 75,388,091 bp (GRCm38)
  • C to T, chromosome 1 at 88,216,260 bp (GRCm38)
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp (GRCm38)
  • G to A, chromosome 2 at 31,674,743 bp (GRCm38)
  • C to T, chromosome 2 at 32,753,027 bp (GRCm38)
  • A to G, chromosome 2 at 90,784,093 bp (GRCm38)
  • A to G, chromosome 2 at 121,209,280 bp (GRCm38)
  • T to A, chromosome 2 at 134,548,261 bp (GRCm38)
  • T to C, chromosome 3 at 37,431,909 bp (GRCm38)
  • T to G, chromosome 3 at 96,042,925 bp (GRCm38)
  • C to A, chromosome 3 at 125,714,647 bp (GRCm38)
  • A to G, chromosome 4 at 32,739,849 bp (GRCm38)
  • C to T, chromosome 4 at 112,806,840 bp (GRCm38)
  • T to C, chromosome 4 at 116,574,361 bp (GRCm38)
  • G to A, chromosome 4 at 147,682,274 bp (GRCm38)
  • C to A, chromosome 5 at 51,495,738 bp (GRCm38)
  • A to C, chromosome 5 at 75,167,927 bp (GRCm38)
  • T to C, chromosome 5 at 96,780,070 bp (GRCm38)
  • T to A, chromosome 5 at 107,620,589 bp (GRCm38)
  • G to A, chromosome 5 at 120,494,380 bp (GRCm38)
  • G to A, chromosome 5 at 120,899,254 bp (GRCm38)
  • T to C, chromosome 5 at 138,607,255 bp (GRCm38)
  • A to G, chromosome 6 at 38,060,982 bp (GRCm38)
  • T to A, chromosome 6 at 40,612,458 bp (GRCm38)
  • A to T, chromosome 6 at 107,568,300 bp (GRCm38)
  • A to T, chromosome 7 at 6,570,819 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to T, chromosome 7 at 46,016,468 bp (GRCm38)
  • A to C, chromosome 7 at 78,302,732 bp (GRCm38)
  • G to A, chromosome 8 at 4,235,346 bp (GRCm38)
  • A to T, chromosome 8 at 54,635,477 bp (GRCm38)
  • C to T, chromosome 8 at 60,934,517 bp (GRCm38)
  • A to G, chromosome 8 at 75,753,455 bp (GRCm38)
  • A to G, chromosome 8 at 113,655,103 bp (GRCm38)
  • T to A, chromosome 8 at 113,777,938 bp (GRCm38)
  • T to C, chromosome 8 at 126,382,254 bp (GRCm38)
  • A to G, chromosome 9 at 13,805,471 bp (GRCm38)
  • T to C, chromosome 9 at 19,713,643 bp (GRCm38)
  • T to C, chromosome 9 at 57,954,905 bp (GRCm38)
  • C to T, chromosome 9 at 60,872,216 bp (GRCm38)
  • T to A, chromosome 9 at 61,956,225 bp (GRCm38)
  • C to A, chromosome 9 at 76,491,803 bp (GRCm38)
  • C to T, chromosome 9 at 106,234,062 bp (GRCm38)
  • T to C, chromosome 10 at 28,334,480 bp (GRCm38)
  • A to G, chromosome 10 at 81,642,299 bp (GRCm38)
  • T to A, chromosome 11 at 3,998,660 bp (GRCm38)
  • G to C, chromosome 11 at 4,213,604 bp (GRCm38)
  • C to T, chromosome 11 at 107,716,292 bp (GRCm38)
  • T to G, chromosome 12 at 53,010,552 bp (GRCm38)
  • T to A, chromosome 12 at 70,346,454 bp (GRCm38)
  • G to A, chromosome 13 at 15,725,711 bp (GRCm38)
  • A to G, chromosome 13 at 64,799,135 bp (GRCm38)
  • T to A, chromosome 13 at 67,102,064 bp (GRCm38)
  • A to G, chromosome 14 at 61,607,657 bp (GRCm38)
  • A to G, chromosome 15 at 30,881,130 bp (GRCm38)
  • G to T, chromosome 16 at 4,875,569 bp (GRCm38)
  • T to C, chromosome 16 at 19,566,520 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • A to T, chromosome 17 at 34,841,102 bp (GRCm38)
  • T to C, chromosome 18 at 21,148,313 bp (GRCm38)
  • A to T, chromosome 18 at 36,529,216 bp (GRCm38)
  • T to A, chromosome 18 at 37,007,538 bp (GRCm38)
  • G to A, chromosome 19 at 38,777,893 bp (GRCm38)
  • T to G, chromosome 19 at 57,239,180 bp (GRCm38)
  • GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT to GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT, chromosome X at 37,878,114 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9475 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069278-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.