Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9482Btlr/Mmmh
Stock Number:
069285-MU
Citation ID:
RRID:MMRRC_069285-MU
Other Names:
R9482 (G1)
Major Collection:

Strain Information

Nucks1
Name: nuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms: Nucks, 2700010L10Rik, 8430423A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98415
Homologene: 23377
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Mycbp
Name: MYC binding protein
Synonyms: Amy-1, 5730488M09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56309
HGNC: HGNC:7554
Homologene: 49312
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 38,868,035 bp (GRCm38)
  • G to T, chromosome 1 at 59,191,950 bp (GRCm38)
  • T to C, chromosome 1 at 74,855,345 bp (GRCm38)
  • CTCCTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCA to C, chromosome 1 at 88,266,274 bp (GRCm38)
  • T to A, chromosome 1 at 93,215,384 bp (GRCm38)
  • A to G, chromosome 1 at 131,919,006 bp (GRCm38)
  • A to G, chromosome 1 at 150,734,530 bp (GRCm38)
  • T to C, chromosome 1 at 170,918,380 bp (GRCm38)
  • CAAA to CAA, chromosome 1 at 189,256,694 bp (GRCm38)
  • C to T, chromosome 2 at 4,919,052 bp (GRCm38)
  • C to T, chromosome 2 at 89,575,609 bp (GRCm38)
  • C to A, chromosome 2 at 121,450,724 bp (GRCm38)
  • T to C, chromosome 2 at 121,450,725 bp (GRCm38)
  • T to C, chromosome 2 at 132,806,779 bp (GRCm38)
  • T to C, chromosome 2 at 140,661,670 bp (GRCm38)
  • C to A, chromosome 2 at 150,192,791 bp (GRCm38)
  • T to C, chromosome 2 at 160,904,496 bp (GRCm38)
  • T to C, chromosome 4 at 73,790,696 bp (GRCm38)
  • T to C, chromosome 4 at 123,910,087 bp (GRCm38)
  • T to G, chromosome 4 at 139,360,890 bp (GRCm38)
  • T to G, chromosome 4 at 148,500,118 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • A to G, chromosome 6 at 91,042,626 bp (GRCm38)
  • G to T, chromosome 7 at 19,038,061 bp (GRCm38)
  • A to T, chromosome 7 at 110,946,052 bp (GRCm38)
  • G to A, chromosome 7 at 116,362,054 bp (GRCm38)
  • A to G, chromosome 7 at 118,848,487 bp (GRCm38)
  • AGCTC to AGCTCAGCCACGGGGACCCGCTC, chromosome 7 at 126,467,596 bp (GRCm38)
  • A to T, chromosome 8 at 57,857,515 bp (GRCm38)
  • T to A, chromosome 9 at 44,316,617 bp (GRCm38)
  • T to C, chromosome 9 at 107,792,009 bp (GRCm38)
  • T to C, chromosome 9 at 110,633,998 bp (GRCm38)
  • C to A, chromosome 10 at 7,919,360 bp (GRCm38)
  • A to G, chromosome 10 at 14,431,679 bp (GRCm38)
  • A to T, chromosome 10 at 80,808,900 bp (GRCm38)
  • A to T, chromosome 10 at 85,979,254 bp (GRCm38)
  • T to C, chromosome 10 at 103,028,474 bp (GRCm38)
  • T to C, chromosome 11 at 67,217,919 bp (GRCm38)
  • T to G, chromosome 11 at 69,852,840 bp (GRCm38)
  • A to G, chromosome 12 at 11,255,185 bp (GRCm38)
  • A to G, chromosome 12 at 79,244,465 bp (GRCm38)
  • T to A, chromosome 14 at 4,320,208 bp (GRCm38)
  • A to T, chromosome 14 at 23,390,965 bp (GRCm38)
  • T to C, chromosome 14 at 62,276,902 bp (GRCm38)
  • C to T, chromosome 14 at 64,113,680 bp (GRCm38)
  • A to C, chromosome 14 at 73,206,053 bp (GRCm38)
  • A to G, chromosome 15 at 68,212,803 bp (GRCm38)
  • A to C, chromosome 15 at 98,865,165 bp (GRCm38)
  • A to G, chromosome 16 at 45,159,118 bp (GRCm38)
  • A to G, chromosome 16 at 65,839,343 bp (GRCm38)
  • A to G, chromosome 18 at 37,301,683 bp (GRCm38)
  • G to T, chromosome 18 at 64,887,960 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9482 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069285-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.