Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9485Btlr/Mmmh
Stock Number:
069288-MU
Citation ID:
RRID:MMRRC_069288-MU
Other Names:
R9485 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Sox9
Name: SRY (sex determining region Y)-box 9
Synonyms: 2010306G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20682
Homologene: 294
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: BAM11, LTG19, ENL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik, nemitin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99512
Homologene: 8984
Wnt7a
Name: wingless-type MMTV integration site family, member 7A
Synonyms: Wnt-7a, tw
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22421
Homologene: 20969
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • T to G, chromosome 1 at 44,056,239 bp (GRCm38)
  • A to G, chromosome 1 at 172,278,255 bp (GRCm38)
  • T to C, chromosome 1 at 177,752,979 bp (GRCm38)
  • C to A, chromosome 1 at 193,130,233 bp (GRCm38)
  • G to A, chromosome 2 at 89,001,365 bp (GRCm38)
  • G to T, chromosome 2 at 120,745,505 bp (GRCm38)
  • T to C, chromosome 2 at 157,229,993 bp (GRCm38)
  • T to C, chromosome 2 at 172,427,885 bp (GRCm38)
  • C to T, chromosome 3 at 59,179,584 bp (GRCm38)
  • T to A, chromosome 3 at 64,275,625 bp (GRCm38)
  • A to T, chromosome 3 at 108,637,055 bp (GRCm38)
  • A to T, chromosome 3 at 115,888,328 bp (GRCm38)
  • T to A, chromosome 4 at 130,137,261 bp (GRCm38)
  • T to A, chromosome 4 at 147,583,823 bp (GRCm38)
  • A to T, chromosome 5 at 23,768,861 bp (GRCm38)
  • C to T, chromosome 5 at 29,781,519 bp (GRCm38)
  • T to C, chromosome 5 at 33,664,300 bp (GRCm38)
  • G to T, chromosome 5 at 35,032,270 bp (GRCm38)
  • T to C, chromosome 5 at 96,082,999 bp (GRCm38)
  • A to T, chromosome 5 at 105,121,930 bp (GRCm38)
  • T to C, chromosome 6 at 3,592,557 bp (GRCm38)
  • C to A, chromosome 6 at 38,703,510 bp (GRCm38)
  • T to A, chromosome 6 at 91,366,315 bp (GRCm38)
  • T to C, chromosome 6 at 124,745,785 bp (GRCm38)
  • T to C, chromosome 6 at 136,909,550 bp (GRCm38)
  • T to G, chromosome 7 at 31,130,538 bp (GRCm38)
  • G to A, chromosome 7 at 45,678,609 bp (GRCm38)
  • C to T, chromosome 7 at 59,987,464 bp (GRCm38)
  • T to A, chromosome 7 at 79,439,657 bp (GRCm38)
  • A to T, chromosome 7 at 102,554,806 bp (GRCm38)
  • C to T, chromosome 7 at 105,069,496 bp (GRCm38)
  • A to T, chromosome 7 at 122,762,212 bp (GRCm38)
  • T to C, chromosome 7 at 133,725,381 bp (GRCm38)
  • T to C, chromosome 8 at 22,012,762 bp (GRCm38)
  • T to A, chromosome 8 at 71,889,825 bp (GRCm38)
  • G to A, chromosome 8 at 80,788,855 bp (GRCm38)
  • T to C, chromosome 9 at 46,241,155 bp (GRCm38)
  • T to G, chromosome 9 at 64,907,106 bp (GRCm38)
  • T to A, chromosome 9 at 95,638,667 bp (GRCm38)
  • T to C, chromosome 9 at 97,080,469 bp (GRCm38)
  • A to G, chromosome 10 at 118,294,409 bp (GRCm38)
  • A to G, chromosome 11 at 112,782,879 bp (GRCm38)
  • G to A, chromosome 12 at 3,866,121 bp (GRCm38)
  • T to C, chromosome 12 at 114,615,905 bp (GRCm38)
  • A to T, chromosome 13 at 60,853,245 bp (GRCm38)
  • A to G, chromosome 13 at 119,790,349 bp (GRCm38)
  • T to C, chromosome 14 at 32,661,443 bp (GRCm38)
  • T to A, chromosome 14 at 51,854,032 bp (GRCm38)
  • T to C, chromosome 14 at 54,944,345 bp (GRCm38)
  • T to A, chromosome 14 at 56,130,703 bp (GRCm38)
  • T to C, chromosome 14 at 57,438,267 bp (GRCm38)
  • A to T, chromosome 14 at 79,768,249 bp (GRCm38)
  • T to C, chromosome 15 at 55,048,271 bp (GRCm38)
  • T to C, chromosome 15 at 100,155,043 bp (GRCm38)
  • T to A, chromosome 16 at 45,677,919 bp (GRCm38)
  • T to A, chromosome 17 at 28,317,505 bp (GRCm38)
  • T to A, chromosome 17 at 34,039,695 bp (GRCm38)
  • C to T, chromosome 17 at 45,560,427 bp (GRCm38)
  • C to T, chromosome 17 at 56,900,184 bp (GRCm38)
  • A to C, chromosome 17 at 58,102,108 bp (GRCm38)
  • T to A, chromosome 17 at 74,638,403 bp (GRCm38)
  • G to A, chromosome 19 at 9,002,074 bp (GRCm38)
  • G to T, chromosome 19 at 18,778,614 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9485 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069288-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.