Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9521Btlr/Mmmh
Stock Number:
069323-MU
Citation ID:
RRID:MMRRC_069323-MU
Other Names:
R9521 (G1)
Major Collection:

Strain Information

Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Tdp1
Name: tyrosyl-DNA phosphodiesterase 1
Synonyms: 4921509N21Rik, SCAN1, 2810481F14Rik, E430034L06Rik, Gm40556
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104884
Homologene: 5424
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Rapgef1
Name: Rap guanine nucleotide exchange factor (GEF) 1
Synonyms: C3G, 4932418O06Rik, Grf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107746
HGNC: HGNC:4568
Homologene: 50501
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
4833420G17Rik
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Ticam1
Name: TIR domain containing adaptor molecule 1
Synonyms: Trif, TICAM-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106759
Homologene: 8605
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Atp1b3
Name: ATPase, Na+/K+ transporting, beta 3 polypeptide
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11933
HGNC: HGNC:806
Homologene: 37510
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Akap8
Name: A kinase anchor protein 8
Synonyms: AKAP95, 1200016A02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56399
VEGA: 17
HGNC: HGNC:378
Homologene: 4278
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Rasgrp3
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Afap1l1
Name: actin filament associated protein 1-like 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106877
Homologene: 18728
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Casr-rs2, EG637873, Gprc2a-rs2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637873
Homologene: 129683
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, Apg9l2, eONE, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Peli2
Name: pellino 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93834
VEGA: 14
HGNC: HGNC:8828
Homologene: 41431
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Ubtd2
Name: ubiquitin domain containing 2
Synonyms: 9630054F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327900
Homologene: 15484
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Cacnb2
Name: calcium channel, voltage-dependent, beta 2 subunit
Synonyms: Cchb2, Cavbeta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12296
HGNC: HGNC:1402
Homologene: 75191
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: Gpcr27, ChemR23
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Ano9
Name: anoctamin 9
Synonyms: 5430425C04Rik, Tp53i5, Trp53i5, Tmem16j
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71345
Homologene: 67083
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Cyp2d22
Name: cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms: 2D22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56448
VEGA: 15
Homologene: 75003
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Unc45b
Name: unc-45 myosin chaperone B
Synonyms: UNC45, D230041A13Rik, Cmya4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217012
Homologene: 14666
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Ercc2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 2
Synonyms: XPD, Ercc-2, RCO015, Mhdarco15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13871
HGNC: HGNC:3434
Homologene: 344
Or52d3
Name: olfactory receptor family 52 subfamily D member 3
Synonyms: GA_x6K02T2PBJ9-7206970-7207923, MOR33-1, Olfr653
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57250
Homologene: 115518
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Mios
Name: meiosis regulator for oocyte development
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 252875
Homologene: 10371
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: GA_x6K02T2Q125-48079993-48079157, MOR192-4_p, Olfr1082
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Keap1
Name: kelch-like ECH-associated protein 1
Synonyms: ring canal protein, INrf2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50868
Homologene: 8184
Chst13
Name: carbohydrate sulfotransferase 13
Synonyms: Chst13, 1110067M19Rik, C4ST-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71797
Homologene: 44360
Gm42669
Name: predicted gene 42669
Type: Gene
Species: Mouse
Chromosome: 5
Nxt2
Name: nuclear transport factor 2-like export factor 2
Synonyms: P15-2, 6330587F24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 237082
Homologene: 10273
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 58,125,063 bp (GRCm38)
  • T to C, chromosome 1 at 80,524,046 bp (GRCm38)
  • C to A, chromosome 1 at 83,059,259 bp (GRCm38)
  • T to A, chromosome 1 at 134,777,325 bp (GRCm38)
  • A to T, chromosome 2 at 14,604,327 bp (GRCm38)
  • A to G, chromosome 2 at 29,734,279 bp (GRCm38)
  • T to C, chromosome 2 at 62,542,156 bp (GRCm38)
  • C to A, chromosome 2 at 86,594,427 bp (GRCm38)
  • T to A, chromosome 2 at 87,510,285 bp (GRCm38)
  • T to C, chromosome 2 at 119,964,498 bp (GRCm38)
  • T to A, chromosome 2 at 122,328,735 bp (GRCm38)
  • A to G, chromosome 2 at 131,073,326 bp (GRCm38)
  • T to A, chromosome 4 at 45,916,283 bp (GRCm38)
  • G to A, chromosome 4 at 137,613,685 bp (GRCm38)
  • T to C, chromosome 5 at 24,388,109 bp (GRCm38)
  • T to A, chromosome 5 at 107,508,026 bp (GRCm38)
  • C to T, chromosome 5 at 113,614,419 bp (GRCm38)
  • C to T, chromosome 6 at 8,233,171 bp (GRCm38)
  • A to G, chromosome 6 at 40,745,184 bp (GRCm38)
  • G to A, chromosome 6 at 90,309,524 bp (GRCm38)
  • G to A, chromosome 6 at 118,540,459 bp (GRCm38)
  • G to A, chromosome 7 at 19,391,974 bp (GRCm38)
  • A to G, chromosome 7 at 42,267,202 bp (GRCm38)
  • A to G, chromosome 7 at 104,579,648 bp (GRCm38)
  • A to T, chromosome 7 at 141,102,314 bp (GRCm38)
  • T to C, chromosome 8 at 85,299,986 bp (GRCm38)
  • A to T, chromosome 8 at 87,782,405 bp (GRCm38)
  • A to T, chromosome 9 at 21,231,840 bp (GRCm38)
  • A to G, chromosome 9 at 22,278,931 bp (GRCm38)
  • C to T, chromosome 9 at 80,067,405 bp (GRCm38)
  • A to G, chromosome 9 at 96,345,858 bp (GRCm38)
  • T to A, chromosome 9 at 99,698,975 bp (GRCm38)
  • C to A, chromosome 9 at 119,958,115 bp (GRCm38)
  • T to C, chromosome 10 at 109,999,984 bp (GRCm38)
  • T to C, chromosome 11 at 32,499,432 bp (GRCm38)
  • C to T, chromosome 11 at 69,358,307 bp (GRCm38)
  • A to G, chromosome 11 at 82,917,760 bp (GRCm38)
  • T to C, chromosome 11 at 83,212,999 bp (GRCm38)
  • AGCAGCAGCAGCAGCAGCAGCCGTCATCATCCCAGCCGCCGCCTCCACTACCGCAGCAGCAGCAGCAGCAGCC to AGCAGCAGCAGCAGCAGCAGCC, chromosome 11 at 94,214,379 bp (GRCm38)
  • A to T, chromosome 11 at 116,448,382 bp (GRCm38)
  • T to C, chromosome 12 at 99,911,647 bp (GRCm38)
  • G to A, chromosome 13 at 73,798,968 bp (GRCm38)
  • T to C, chromosome 13 at 119,472,242 bp (GRCm38)
  • A to G, chromosome 14 at 48,252,595 bp (GRCm38)
  • C to G, chromosome 15 at 76,178,724 bp (GRCm38)
  • A to T, chromosome 15 at 82,372,487 bp (GRCm38)
  • G to T, chromosome 15 at 99,280,538 bp (GRCm38)
  • A to G, chromosome 15 at 99,943,590 bp (GRCm38)
  • A to G, chromosome 16 at 56,171,781 bp (GRCm38)
  • C to T, chromosome 17 at 3,198,010 bp (GRCm38)
  • C to T, chromosome 17 at 32,311,062 bp (GRCm38)
  • T to C, chromosome 17 at 56,271,388 bp (GRCm38)
  • T to A, chromosome 17 at 75,514,163 bp (GRCm38)
  • T to C, chromosome 18 at 34,312,685 bp (GRCm38)
  • C to T, chromosome 18 at 61,746,792 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • C to T, chromosome X at 142,237,751 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9521 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069323-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.