Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9521Btlr/Mmmh
Stock Number:
069323-MU
Citation ID:
RRID:MMRRC_069323-MU
Other Names:
R9521 (G1)
Major Collection:

Strain Information

Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Tdp1
Name: tyrosyl-DNA phosphodiesterase 1
Synonyms: 4921509N21Rik, SCAN1, 2810481F14Rik, E430034L06Rik, Gm40556
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104884
Homologene: 5424
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 58,125,063 bp (GRCm38)
  • T to C, chromosome 1 at 80,524,046 bp (GRCm38)
  • C to A, chromosome 1 at 83,059,259 bp (GRCm38)
  • T to A, chromosome 1 at 134,777,325 bp (GRCm38)
  • A to T, chromosome 2 at 14,604,327 bp (GRCm38)
  • A to G, chromosome 2 at 29,734,279 bp (GRCm38)
  • T to C, chromosome 2 at 62,542,156 bp (GRCm38)
  • C to A, chromosome 2 at 86,594,427 bp (GRCm38)
  • T to A, chromosome 2 at 87,510,285 bp (GRCm38)
  • T to C, chromosome 2 at 119,964,498 bp (GRCm38)
  • T to A, chromosome 2 at 122,328,735 bp (GRCm38)
  • A to G, chromosome 2 at 131,073,326 bp (GRCm38)
  • T to A, chromosome 4 at 45,916,283 bp (GRCm38)
  • G to A, chromosome 4 at 137,613,685 bp (GRCm38)
  • T to C, chromosome 5 at 24,388,109 bp (GRCm38)
  • T to A, chromosome 5 at 107,508,026 bp (GRCm38)
  • C to T, chromosome 5 at 113,614,419 bp (GRCm38)
  • C to T, chromosome 6 at 8,233,171 bp (GRCm38)
  • A to G, chromosome 6 at 40,745,184 bp (GRCm38)
  • G to A, chromosome 6 at 90,309,524 bp (GRCm38)
  • G to A, chromosome 6 at 118,540,459 bp (GRCm38)
  • G to A, chromosome 7 at 19,391,974 bp (GRCm38)
  • A to G, chromosome 7 at 42,267,202 bp (GRCm38)
  • A to G, chromosome 7 at 104,579,648 bp (GRCm38)
  • A to T, chromosome 7 at 141,102,314 bp (GRCm38)
  • T to C, chromosome 8 at 85,299,986 bp (GRCm38)
  • A to T, chromosome 8 at 87,782,405 bp (GRCm38)
  • A to T, chromosome 9 at 21,231,840 bp (GRCm38)
  • A to G, chromosome 9 at 22,278,931 bp (GRCm38)
  • C to T, chromosome 9 at 80,067,405 bp (GRCm38)
  • A to G, chromosome 9 at 96,345,858 bp (GRCm38)
  • T to A, chromosome 9 at 99,698,975 bp (GRCm38)
  • C to A, chromosome 9 at 119,958,115 bp (GRCm38)
  • T to C, chromosome 10 at 109,999,984 bp (GRCm38)
  • T to C, chromosome 11 at 32,499,432 bp (GRCm38)
  • C to T, chromosome 11 at 69,358,307 bp (GRCm38)
  • A to G, chromosome 11 at 82,917,760 bp (GRCm38)
  • T to C, chromosome 11 at 83,212,999 bp (GRCm38)
  • AGCAGCAGCAGCAGCAGCAGCCGTCATCATCCCAGCCGCCGCCTCCACTACCGCAGCAGCAGCAGCAGCAGCC to AGCAGCAGCAGCAGCAGCAGCC, chromosome 11 at 94,214,379 bp (GRCm38)
  • A to T, chromosome 11 at 116,448,382 bp (GRCm38)
  • T to C, chromosome 12 at 99,911,647 bp (GRCm38)
  • G to A, chromosome 13 at 73,798,968 bp (GRCm38)
  • T to C, chromosome 13 at 119,472,242 bp (GRCm38)
  • A to G, chromosome 14 at 48,252,595 bp (GRCm38)
  • C to G, chromosome 15 at 76,178,724 bp (GRCm38)
  • A to T, chromosome 15 at 82,372,487 bp (GRCm38)
  • G to T, chromosome 15 at 99,280,538 bp (GRCm38)
  • A to G, chromosome 15 at 99,943,590 bp (GRCm38)
  • A to G, chromosome 16 at 56,171,781 bp (GRCm38)
  • C to T, chromosome 17 at 3,198,010 bp (GRCm38)
  • C to T, chromosome 17 at 32,311,062 bp (GRCm38)
  • T to C, chromosome 17 at 56,271,388 bp (GRCm38)
  • T to A, chromosome 17 at 75,514,163 bp (GRCm38)
  • T to C, chromosome 18 at 34,312,685 bp (GRCm38)
  • C to T, chromosome 18 at 61,746,792 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • C to T, chromosome X at 142,237,751 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9521 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069323-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.