Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9528Btlr/Mmmh
Stock Number:
069329-MU
Citation ID:
RRID:MMRRC_069329-MU
Other Names:
R9528 (G1)
Major Collection:

Strain Information

Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
Secisbp2
Name: SECIS binding protein 2
Synonyms: 2210413N07Rik, SBP2, 2810012K13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75420
Homologene: 11415
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Abi2
Name: abl interactor 2
Synonyms: 8430425M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329165
Homologene: 4209
Ppp2r1a
Name: protein phosphatase 2, regulatory subunit A, alpha
Synonyms: PR65, protein phosphatase PP2A, 6330556D22Rik, PP2A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 51792
HGNC: HGNC:9302
Homologene: 68559
Clptm1l
Name: CLPTM1-like
Synonyms: C130052I12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218335
VEGA: 13
Homologene: 12767
Crot
Name: carnitine O-octanoyltransferase
Synonyms: 1200003H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74114
HGNC: HGNC:2366
Homologene: 10899
Txnrd3
Name: thioredoxin reductase 3
Synonyms: TR2, Tgr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232223
Homologene: 60033
Mmp17
Name: matrix metallopeptidase 17
Synonyms: MT4-MMP, membrane type-4 matrix metalloproteinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23948
HGNC: HGNC:7163
Homologene: 22669
Lipc
Name: lipase, hepatic
Synonyms: HL, Hpl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15450
VEGA: 9
HGNC: HGNC:6619
Homologene: 199
Sarnp
Name: SAP domain containing ribonucleoprotein
Synonyms: 1110005A23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66118
VEGA: 10
Homologene: 41628
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Zfp148
Name: zinc finger protein 148
Synonyms: beta enolase repressor factor 1, BERF-1, BFCOL1, 2210405J08Rik, ZBP-89
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22661
VEGA: 16
Homologene: 8003
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: Rme8, LOC382100, D030002L11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235567
Homologene: 13574
Adgrd1
Name: adhesion G protein-coupled receptor D1
Synonyms: E230012M21Rik, Gpr133
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243277
Homologene: 34616
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Btnl1
Name: butyrophilin-like 1
Synonyms: NG10, LOC240074, LOC240074, Btnl3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038862
Homologene: 103816
Or14a258
Name: olfactory receptor family 14 subfamily A member 258
Synonyms: GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P, Olfr304
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258089
Homologene: 121542
Alpi
Name: alkaline phosphatase, intestinal
Synonyms: 2010001C14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76768
Homologene: 122414
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Myo1f
Name: myosin IF
Synonyms: C330006B10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17916
HGNC: HGNC:7600
Homologene: 56276
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Or10h28
Name: olfactory receptor family 10 subfamily H member 28
Synonyms: M4, MOR267-1, GA_x6K02T2NTC5-9778-8828, Olfr63
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258939
Homologene: 130665
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433492
Homologene: 128535
Or7g31
Name: olfactory receptor family 7 subfamily G member 31
Synonyms: GA_x6K02T2PVTD-13214162-13213224, MOR147-2, Olfr850
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258516
HGNC: HGNC:8466
Homologene: 121552
6030452D12Rik
Name: RIKEN cDNA 6030452D12 gene
Type: Gene
Species: Mouse
Chromosome: 8
Lrfn5
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238205
Homologene: 17582
Dpep3
Name: dipeptidase 3
Synonyms: 1700018F16Rik, MBD-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71854
Homologene: 23357
Wars2
Name: tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms: 9430020O07Rik, TrpRS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70560
Homologene: 5673
Or1o3
Name: olfactory receptor family 1 subfamily O member 3
Synonyms: MOR156-4, GA_x6K02T2PSCP-1703582-1702653, Olfr98
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258503
Homologene: 133051
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Lekr1
Name: leucine, glutamate and lysine rich 1
Synonyms: EG546798, Gm6534
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 624866
Homologene: 54497
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 60,434,294 bp (GRCm38)
  • T to A, chromosome 1 at 75,387,803 bp (GRCm38)
  • A to G, chromosome 1 at 87,099,050 bp (GRCm38)
  • T to A, chromosome 1 at 90,804,067 bp (GRCm38)
  • A to G, chromosome 2 at 154,311,377 bp (GRCm38)
  • T to C, chromosome 3 at 65,684,187 bp (GRCm38)
  • A to G, chromosome 3 at 99,204,606 bp (GRCm38)
  • T to C, chromosome 4 at 33,081,483 bp (GRCm38)
  • A to T, chromosome 5 at 8,993,575 bp (GRCm38)
  • G to A, chromosome 5 at 14,677,677 bp (GRCm38)
  • T to C, chromosome 5 at 65,156,243 bp (GRCm38)
  • A to G, chromosome 5 at 129,179,676 bp (GRCm38)
  • G to C, chromosome 5 at 129,606,328 bp (GRCm38)
  • A to G, chromosome 6 at 89,672,972 bp (GRCm38)
  • T to A, chromosome 7 at 86,385,851 bp (GRCm38)
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp (GRCm38)
  • C to A, chromosome 8 at 105,977,619 bp (GRCm38)
  • A to T, chromosome 8 at 106,504,497 bp (GRCm38)
  • A to G, chromosome 9 at 19,478,148 bp (GRCm38)
  • C to A, chromosome 9 at 42,022,335 bp (GRCm38)
  • A to T, chromosome 9 at 70,934,559 bp (GRCm38)
  • T to A, chromosome 9 at 73,930,678 bp (GRCm38)
  • T to C, chromosome 9 at 104,237,705 bp (GRCm38)
  • A to G, chromosome 10 at 128,872,457 bp (GRCm38)
  • T to A, chromosome 12 at 61,839,622 bp (GRCm38)
  • A to G, chromosome 13 at 51,656,943 bp (GRCm38)
  • A to C, chromosome 13 at 63,513,801 bp (GRCm38)
  • G to A, chromosome 13 at 73,612,431 bp (GRCm38)
  • T to C, chromosome 14 at 30,601,811 bp (GRCm38)
  • T to A, chromosome 15 at 76,176,833 bp (GRCm38)
  • C to A, chromosome 16 at 31,111,090 bp (GRCm38)
  • T to A, chromosome 16 at 33,496,290 bp (GRCm38)
  • A to G, chromosome 17 at 20,955,891 bp (GRCm38)
  • T to A, chromosome 17 at 33,269,471 bp (GRCm38)
  • T to C, chromosome 17 at 33,578,182 bp (GRCm38)
  • T to A, chromosome 17 at 34,384,378 bp (GRCm38)
  • T to A, chromosome 17 at 37,263,196 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9528 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069329-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.