Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9546Btlr/Mmmh
Stock Number:
069342-MU
Citation ID:
RRID:MMRRC_069342-MU
Other Names:
R9546 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 75,505,386 bp (GRCm38)
  • T to A, chromosome 1 at 134,485,824 bp (GRCm38)
  • A to C, chromosome 1 at 181,593,427 bp (GRCm38)
  • C to T, chromosome 2 at 25,272,304 bp (GRCm38)
  • T to A, chromosome 2 at 26,481,115 bp (GRCm38)
  • A to T, chromosome 2 at 66,752,259 bp (GRCm38)
  • A to G, chromosome 2 at 69,456,821 bp (GRCm38)
  • T to C, chromosome 2 at 88,423,705 bp (GRCm38)
  • C to T, chromosome 2 at 90,444,461 bp (GRCm38)
  • T to A, chromosome 2 at 91,113,272 bp (GRCm38)
  • AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG to AGCAGCAGTGGTGGAGG, chromosome 2 at 154,863,834 bp (GRCm38)
  • T to C, chromosome 3 at 87,360,894 bp (GRCm38)
  • T to A, chromosome 4 at 49,514,338 bp (GRCm38)
  • A to C, chromosome 4 at 74,404,867 bp (GRCm38)
  • A to G, chromosome 4 at 108,513,232 bp (GRCm38)
  • G to T, chromosome 4 at 136,938,586 bp (GRCm38)
  • A to T, chromosome 4 at 143,134,991 bp (GRCm38)
  • T to C, chromosome 4 at 155,649,132 bp (GRCm38)
  • T to C, chromosome 5 at 64,173,607 bp (GRCm38)
  • T to A, chromosome 5 at 140,328,579 bp (GRCm38)
  • A to C, chromosome 6 at 123,787,307 bp (GRCm38)
  • A to C, chromosome 6 at 129,405,204 bp (GRCm38)
  • A to T, chromosome 7 at 43,474,467 bp (GRCm38)
  • A to T, chromosome 8 at 54,659,700 bp (GRCm38)
  • A to T, chromosome 8 at 88,652,993 bp (GRCm38)
  • A to G, chromosome 9 at 104,054,368 bp (GRCm38)
  • A to T, chromosome 9 at 113,655,106 bp (GRCm38)
  • A to G, chromosome 9 at 121,789,583 bp (GRCm38)
  • A to T, chromosome 10 at 3,551,884 bp (GRCm38)
  • C to T, chromosome 10 at 5,243,123 bp (GRCm38)
  • C to A, chromosome 10 at 29,146,809 bp (GRCm38)
  • G to A, chromosome 10 at 33,779,674 bp (GRCm38)
  • C to T, chromosome 10 at 52,118,119 bp (GRCm38)
  • A to G, chromosome 10 at 80,321,907 bp (GRCm38)
  • A to G, chromosome 10 at 94,190,666 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to G, chromosome 11 at 11,943,919 bp (GRCm38)
  • A to G, chromosome 11 at 58,859,096 bp (GRCm38)
  • T to C, chromosome 11 at 61,546,581 bp (GRCm38)
  • A to T, chromosome 11 at 102,148,255 bp (GRCm38)
  • G to A, chromosome 11 at 103,910,449 bp (GRCm38)
  • A to G, chromosome 11 at 106,410,027 bp (GRCm38)
  • G to A, chromosome 11 at 110,244,216 bp (GRCm38)
  • C to A, chromosome 12 at 88,181,881 bp (GRCm38)
  • A to G, chromosome 12 at 115,623,265 bp (GRCm38)
  • C to T, chromosome 13 at 11,587,215 bp (GRCm38)
  • T to A, chromosome 13 at 15,613,858 bp (GRCm38)
  • A to T, chromosome 13 at 27,094,999 bp (GRCm38)
  • T to C, chromosome 13 at 97,185,668 bp (GRCm38)
  • T to A, chromosome 13 at 110,398,767 bp (GRCm38)
  • T to C, chromosome 14 at 52,215,951 bp (GRCm38)
  • G to T, chromosome 14 at 72,480,907 bp (GRCm38)
  • T to A, chromosome 14 at 77,068,873 bp (GRCm38)
  • T to C, chromosome 14 at 103,843,023 bp (GRCm38)
  • G to A, chromosome 15 at 3,969,011 bp (GRCm38)
  • A to G, chromosome 15 at 58,126,577 bp (GRCm38)
  • T to C, chromosome 16 at 17,499,740 bp (GRCm38)
  • G to A, chromosome 17 at 18,441,459 bp (GRCm38)
  • T to A, chromosome 17 at 30,153,328 bp (GRCm38)
  • A to T, chromosome 17 at 42,667,392 bp (GRCm38)
  • A to G, chromosome 18 at 34,312,258 bp (GRCm38)
  • C to T, chromosome 18 at 36,946,336 bp (GRCm38)
  • A to T, chromosome 19 at 53,002,528 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9546 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069342-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.