Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9546Btlr/Mmmh
Stock Number:
069342-MU
Citation ID:
RRID:MMRRC_069342-MU
Other Names:
R9546 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Xpnpep1
Name: X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms: D230045I08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170750
Homologene: 6424
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Zcchc11, Tent3a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Grb10
Name: growth factor receptor bound protein 10
Synonyms: Meg1, maternally expressed gene 1, 5730571D09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14783
HGNC: HGNC:4564
Homologene: 3882
Nr2c1
Name: nuclear receptor subfamily 2, group C, member 1
Synonyms: TR2, Tr2-11, 4831444H07Rik, Eenr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22025
HGNC: HGNC:7971
Homologene: 55731
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: 5830451P18Rik, Duplin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Plk2
Name: polo like kinase 2
Synonyms: Snk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20620
VEGA: 13
Homologene: 21317
Zfand3
Name: zinc finger, AN1-type domain 3
Synonyms: TEG-27, Tex27
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21769
VEGA: 17
Homologene: 11077
Ern1
Name: endoplasmic reticulum to nucleus signalling 1
Synonyms: 9030414B18Rik, Ire1p, Ire1alpha, Ire1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78943
HGNC: HGNC:3449
Homologene: 55580
Clec1b
Name: C-type lectin domain family 1, member b
Synonyms: Clec-2, 1810061I13Rik, Clec2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56760
Homologene: 49468
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Notch1
Name: notch 1
Synonyms: lin-12, Tan1, Mis6, 9930111A19Rik, Motch A, N1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18128
HGNC: HGNC:7881
Homologene: 32049
Epn2
Name: epsin 2
Synonyms: Ibp2, 9530051D10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13855
Homologene: 40710
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78249
Homologene: 51953
Aifm3
Name: apoptosis-inducing factor, mitochondrion-associated 3
Synonyms: 2810401C16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72168
Homologene: 13773
Sult3a2
Name: sulfotransferase family 3A, member 2
Synonyms: Gm4794
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215895
VEGA: 10
Homologene: 111031
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Uba5
Name: ubiquitin-like modifier activating enzyme 5
Synonyms: 5730525G14Rik, Ube1dc1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66663
Homologene: 11738
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: Bph, brachyphalangy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Iglon5
Name: IgLON family member 5
Synonyms: A230106M20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210094
Homologene: 46295
Raly
Name: hnRNP-associated with lethal yellow
Synonyms: Merc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19383
Homologene: 7216
Nags
Name: N-acetylglutamate synthase
Synonyms: 1700120E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217214
Homologene: 77363
Hhatl
Name: hedgehog acyltransferase-like
Synonyms: 1110011D13Rik, Gup1, Mitsugumin 56, Mg56
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74770
VEGA: 9
Homologene: 19287
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Nlrc2, Card15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Mrpl50
Name: mitochondrial ribosomal protein L50
Synonyms: D4Wsu125e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 28028
Homologene: 32436
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243628
Homologene: 135915
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Mtcl3
Name: MTCL family member 3
Synonyms: 6330407J23Rik, Soga3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67412
VEGA: 10
Homologene: 28227
Pcsk4
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18551
HGNC: HGNC:8746
Homologene: 22495
Iyd
Name: iodotyrosine deiodinase
Synonyms: 0610009A07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70337
Homologene: 12352
Ccdc122
Name: coiled-coil domain containing 122
Synonyms: 4933415L06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108811
Homologene: 51651
Ssna1
Name: SS nuclear autoantigen 1
Synonyms: 1190004J23Rik, 1110003H09Rik, NA14, N14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68475
Homologene: 2768
Cd5l
Name: CD5 antigen-like
Synonyms: AAC-11, AIM/Spalpha, Sp-alpha, Pdp 1/6, Api6, AIM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11801
HGNC: HGNC:1690
Homologene: 55936
Prl3d1
Name: prolactin family 3, subfamily d, member 1
Synonyms: Pl-1, Pl1, prolactin-like 2, PL-Ia, Csh1, mPL-I, placental lactogen 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18775
Homologene: 137215
Mrm2
Name: mitochondrial rRNA methyltransferase 2
Synonyms: 2310037B18Rik, Ftsj2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68017
Homologene: 5907
Fbxo4
Name: F-box protein 4
Synonyms: 1700096C12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106052
Homologene: 8134
Spi1
Name: Spi-1 proto-oncogene
Synonyms: Spi-1, Sfpi-1, Tfpu.1, PU.1, Dis-1, Tcfpu1, Sfpi1, spleen focus forming virus (SFFV) proviral integration oncogene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20375
Homologene: 2346
Or4p20
Name: olfactory receptor family 4 subfamily P member 20
Synonyms: GA_x6K02T2Q125-49911636-49910701, MOR225-9P, Olfr1181
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258060
Homologene: 86666
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 75,505,386 bp (GRCm38)
  • T to A, chromosome 1 at 134,485,824 bp (GRCm38)
  • A to C, chromosome 1 at 181,593,427 bp (GRCm38)
  • C to T, chromosome 2 at 25,272,304 bp (GRCm38)
  • T to A, chromosome 2 at 26,481,115 bp (GRCm38)
  • A to T, chromosome 2 at 66,752,259 bp (GRCm38)
  • A to G, chromosome 2 at 69,456,821 bp (GRCm38)
  • T to C, chromosome 2 at 88,423,705 bp (GRCm38)
  • C to T, chromosome 2 at 90,444,461 bp (GRCm38)
  • T to A, chromosome 2 at 91,113,272 bp (GRCm38)
  • AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG to AGCAGCAGTGGTGGAGG, chromosome 2 at 154,863,834 bp (GRCm38)
  • T to C, chromosome 3 at 87,360,894 bp (GRCm38)
  • T to A, chromosome 4 at 49,514,338 bp (GRCm38)
  • A to C, chromosome 4 at 74,404,867 bp (GRCm38)
  • A to G, chromosome 4 at 108,513,232 bp (GRCm38)
  • G to T, chromosome 4 at 136,938,586 bp (GRCm38)
  • A to T, chromosome 4 at 143,134,991 bp (GRCm38)
  • T to C, chromosome 4 at 155,649,132 bp (GRCm38)
  • T to C, chromosome 5 at 64,173,607 bp (GRCm38)
  • T to A, chromosome 5 at 140,328,579 bp (GRCm38)
  • A to C, chromosome 6 at 123,787,307 bp (GRCm38)
  • A to C, chromosome 6 at 129,405,204 bp (GRCm38)
  • A to T, chromosome 7 at 43,474,467 bp (GRCm38)
  • A to T, chromosome 8 at 54,659,700 bp (GRCm38)
  • A to T, chromosome 8 at 88,652,993 bp (GRCm38)
  • A to G, chromosome 9 at 104,054,368 bp (GRCm38)
  • A to T, chromosome 9 at 113,655,106 bp (GRCm38)
  • A to G, chromosome 9 at 121,789,583 bp (GRCm38)
  • A to T, chromosome 10 at 3,551,884 bp (GRCm38)
  • C to T, chromosome 10 at 5,243,123 bp (GRCm38)
  • C to A, chromosome 10 at 29,146,809 bp (GRCm38)
  • G to A, chromosome 10 at 33,779,674 bp (GRCm38)
  • C to T, chromosome 10 at 52,118,119 bp (GRCm38)
  • A to G, chromosome 10 at 80,321,907 bp (GRCm38)
  • A to G, chromosome 10 at 94,190,666 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to G, chromosome 11 at 11,943,919 bp (GRCm38)
  • A to G, chromosome 11 at 58,859,096 bp (GRCm38)
  • T to C, chromosome 11 at 61,546,581 bp (GRCm38)
  • A to T, chromosome 11 at 102,148,255 bp (GRCm38)
  • G to A, chromosome 11 at 103,910,449 bp (GRCm38)
  • A to G, chromosome 11 at 106,410,027 bp (GRCm38)
  • G to A, chromosome 11 at 110,244,216 bp (GRCm38)
  • C to A, chromosome 12 at 88,181,881 bp (GRCm38)
  • A to G, chromosome 12 at 115,623,265 bp (GRCm38)
  • C to T, chromosome 13 at 11,587,215 bp (GRCm38)
  • T to A, chromosome 13 at 15,613,858 bp (GRCm38)
  • A to T, chromosome 13 at 27,094,999 bp (GRCm38)
  • T to C, chromosome 13 at 97,185,668 bp (GRCm38)
  • T to A, chromosome 13 at 110,398,767 bp (GRCm38)
  • T to C, chromosome 14 at 52,215,951 bp (GRCm38)
  • G to T, chromosome 14 at 72,480,907 bp (GRCm38)
  • T to A, chromosome 14 at 77,068,873 bp (GRCm38)
  • T to C, chromosome 14 at 103,843,023 bp (GRCm38)
  • G to A, chromosome 15 at 3,969,011 bp (GRCm38)
  • A to G, chromosome 15 at 58,126,577 bp (GRCm38)
  • T to C, chromosome 16 at 17,499,740 bp (GRCm38)
  • G to A, chromosome 17 at 18,441,459 bp (GRCm38)
  • T to A, chromosome 17 at 30,153,328 bp (GRCm38)
  • A to T, chromosome 17 at 42,667,392 bp (GRCm38)
  • A to G, chromosome 18 at 34,312,258 bp (GRCm38)
  • C to T, chromosome 18 at 36,946,336 bp (GRCm38)
  • A to T, chromosome 19 at 53,002,528 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9546 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069342-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.