Strain Name:
C57BL/6J-MtgxR9548Btlr/Mmmh
Stock Number:
069344-MU
Citation ID:
RRID:MMRRC_069344-MU
Other Names:
R9548 (G1)
Major Collection:

Strain Information

Ifng
Name: interferon gamma
Synonyms: Ifg, IFN-gamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15978
VEGA: 10
HGNC: HGNC:5438
Homologene: 55526
Med1
Name: mediator complex subunit 1
Synonyms: l11Jus15, TRAP220, PBP, DRIP205, Pparbp, CRSP210, TRAP 220
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Fis1
Name: fission, mitochondrial 1
Synonyms: Ttc11, 2010003O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66437
Homologene: 41099
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Tpl2, Cot, Cot/Tpl2, Tpl-2, c-COT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: D5Ertd66e, Bwf1, 2610509D04Rik, Bchs, Ggtb3, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: Lrrc16, 1110037D04Rik, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: Tex271, TEG-271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108937
Homologene: 47510
Ankfy1
Name: ankyrin repeat and FYVE domain containing 1
Synonyms: Ankhzn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11736
Homologene: 9491
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: 9330189K18Rik, B230217J03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Hook1
Name: hook microtubule tethering protein 1
Synonyms: azh, abnormal spermatozoon head shape, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Bcl2
Name: B cell leukemia/lymphoma 2
Synonyms: C430015F12Rik, Bcl-2, D830018M01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12043
HGNC: HGNC:990
Homologene: 527
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: TFIIIB50, 5730512K07Rik, BRFU, 2700059M06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Epn2
Name: epsin 2
Synonyms: Ibp2, 9530051D10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13855
Homologene: 40710
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Synj2bp
Name: synaptojanin 2 binding protein
Synonyms: D12Wsu118e, OMP25, ARIP2, activin receptor interacting protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24071
Homologene: 10161
Pcdh17
Name: protocadherin 17
Synonyms: LOC219228, C030033F14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219228
VEGA: 14
Homologene: 8700
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Dnahc5, Mdnah5, b2b1134Clo, b2b1154Clo, b2b1537Clo, b2b1565Clo, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: b2b1554Clo, A2mr, CD91
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Cfap53
Name: cilia and flagella associated protein 53
Synonyms: Ccdc11, 4933415I03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74453
Homologene: 27056
Pdzd8
Name: PDZ domain containing 8
Synonyms: Pdzk8, A630041P07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Cyp4f40
Name: cytochrome P450, family 4, subfamily f, polypeptide 40
Synonyms: EG631304
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 631304
VEGA: 17
Homologene: 117991
Exoc3
Name: exocyst complex component 3
Synonyms: 2810050O03Rik, E430013E20Rik, Sec6l1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC5, 2300002I04Rik, MUC9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Cytip
Name: cytohesin 1 interacting protein
Synonyms: A130053M09Rik, Cbp, Pscdbp, Cybr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227929
HGNC: HGNC:9506
Homologene: 3167
Slc1a4
Name: solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms: ASCT1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55963
Homologene: 20655
Steap1
Name: six transmembrane epithelial antigen of the prostate 1
Synonyms: 2410007B19Rik, Prss24
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70358
Homologene: 8256
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Or5w8
Name: olfactory receptor family 5 subfamily W member 8
Synonyms: MOR177-9, Olfr1151, GA_x6K02T2Q125-49358694-49359620
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258631
Homologene: 36999
Smarcal1
Name: SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms: 6030401P21Rik, Mharp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54380
Homologene: 8558
Sh3bp1
Name: SH3-domain binding protein 1
Synonyms: 3BP-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20401
Homologene: 7534
Slc22a19
Name: solute carrier family 22 (organic anion transporter), member 19
Synonyms: Oat5, D630043A20Rik, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207151
Homologene: 133125
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Urgcp
Name: upregulator of cell proliferation
Synonyms: 2010005J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72046
Homologene: 69243
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, Olfr504, MOR40-7P, MOR40-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258163
Homologene: 17189
Vmn1r184
Name: vomeronasal 1 receptor, 184
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312477
Homologene: 74353
Grip1
Name: glutamate receptor interacting protein 1
Synonyms: eb, 4931400F03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74053
Homologene: 12938
Dnaaf2
Name: dynein, axonemal assembly factor 2
Synonyms: Ktu, 2810020C19Rik, 1110034A24Rik, kintoun
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109065
Homologene: 10026
Or4b1b
Name: olfactory receptor family 4 subfamily B member 1B
Synonyms: Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258982
HGNC: HGNC:8290
Homologene: 133649
Slc22a16
Name: solute carrier family 22 (organic cation transporter), member 16
Synonyms: OKB1, FLIPT2, CT2, OCT6, 4921504E14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70840
Homologene: 41957
Skint9
Name: selection and upkeep of intraepithelial T cells 9
Synonyms: A030013N09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329918
Homologene: 136292
Cma2
Name: chymase 2, mast cell
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545055
VEGA: 14
Homologene: 115745
Lrrc14b
Name: leucine rich repeat containing 14B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432779
Homologene: 47758
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Cd44
Name: CD44 antigen
Synonyms: Pgp-1, HERMES, Ly-24
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12505
HGNC: HGNC:1681
Homologene: 508
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Gm10309
Name: predicted gene 10309
Type: Gene
Species: Mouse
Chromosome: 17
Maml3
Name: mastermind like transcriptional coactivator 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433586
Homologene: 41284
Or5p72
Name: olfactory receptor family 5 subfamily P member 72
Synonyms: Olfr497, MOR204-9, GA_x6K02T2PBJ9-10752603-10753547
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258733
Homologene: 133602
Fbxo10
Name: F-box protein 10
Synonyms: LOC269529, FBX10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269529
Homologene: 19544
Cavin4
Name: caveolae associated 4
Synonyms: Murc, 2310039E09Rik, cavin 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68016
Homologene: 12224
Lect2
Name: leukocyte cell-derived chemotaxin 2
Synonyms: chondromodulin-II
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16841
VEGA: 13
HGNC: HGNC:6550
Homologene: 1730
Or12e10
Name: olfactory receptor family 12 subfamily E member 10
Synonyms: Olfr1145, MOR264-19, GA_x6K02T2Q125-49311440-49312384
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258317
Homologene: 27123
Tcstv7a
Name: Tcstv family member 7A
Synonyms: clone L5, AF067063, clone L2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380878
Cd300lf
Name: CD300 molecule like family member F
Synonyms: LMIR3, CLM-1, F730004D16Rik, IgSF13, IREM1, Pigr3, DIgR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246746
Homologene: 51396
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Mpk4, Pyst3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 72,632,840 bp (GRCm38)
  • C to A, chromosome 1 at 106,712,778 bp (GRCm38)
  • A to T, chromosome 2 at 58,151,129 bp (GRCm38)
  • T to C, chromosome 2 at 76,743,347 bp (GRCm38)
  • A to T, chromosome 2 at 87,810,753 bp (GRCm38)
  • A to T, chromosome 2 at 87,857,696 bp (GRCm38)
  • T to C, chromosome 2 at 90,281,647 bp (GRCm38)
  • A to T, chromosome 2 at 102,831,487 bp (GRCm38)
  • A to T, chromosome 3 at 51,856,370 bp (GRCm38)
  • C to A, chromosome 4 at 45,058,970 bp (GRCm38)
  • T to C, chromosome 4 at 48,663,956 bp (GRCm38)
  • T to A, chromosome 4 at 96,003,571 bp (GRCm38)
  • T to G, chromosome 4 at 112,419,149 bp (GRCm38)
  • T to C, chromosome 4 at 156,217,833 bp (GRCm38)
  • A to G, chromosome 5 at 5,740,700 bp (GRCm38)
  • G to A, chromosome 5 at 9,440,859 bp (GRCm38)
  • T to C, chromosome 5 at 101,885,193 bp (GRCm38)
  • C to T, chromosome 5 at 114,361,093 bp (GRCm38)
  • A to T, chromosome 5 at 136,963,053 bp (GRCm38)
  • C to T, chromosome 5 at 137,403,061 bp (GRCm38)
  • G to A, chromosome 7 at 26,267,309 bp (GRCm38)
  • A to G, chromosome 7 at 27,129,745 bp (GRCm38)
  • C to T, chromosome 7 at 30,481,450 bp (GRCm38)
  • A to T, chromosome 7 at 99,925,483 bp (GRCm38)
  • A to T, chromosome 7 at 108,423,209 bp (GRCm38)
  • A to T, chromosome 7 at 108,565,127 bp (GRCm38)
  • C to A, chromosome 7 at 141,867,911 bp (GRCm38)
  • A to T, chromosome 8 at 27,124,595 bp (GRCm38)
  • A to T, chromosome 8 at 95,756,226 bp (GRCm38)
  • G to T, chromosome 9 at 56,206,633 bp (GRCm38)
  • C to A, chromosome 9 at 107,955,900 bp (GRCm38)
  • T to A, chromosome 10 at 40,584,869 bp (GRCm38)
  • T to C, chromosome 10 at 81,277,999 bp (GRCm38)
  • C to A, chromosome 10 at 118,441,223 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • T to G, chromosome 10 at 127,552,864 bp (GRCm38)
  • C to A, chromosome 11 at 5,717,622 bp (GRCm38)
  • A to T, chromosome 11 at 20,308,041 bp (GRCm38)
  • A to G, chromosome 11 at 60,753,942 bp (GRCm38)
  • A to T, chromosome 11 at 61,546,162 bp (GRCm38)
  • G to A, chromosome 11 at 72,750,179 bp (GRCm38)
  • G to T, chromosome 11 at 98,180,058 bp (GRCm38)
  • T to C, chromosome 11 at 115,117,032 bp (GRCm38)
  • T to G, chromosome 12 at 17,416,143 bp (GRCm38)
  • T to C, chromosome 12 at 69,198,002 bp (GRCm38)
  • T to C, chromosome 12 at 81,504,608 bp (GRCm38)
  • T to A, chromosome 12 at 103,011,236 bp (GRCm38)
  • C to A, chromosome 13 at 24,276,533 bp (GRCm38)
  • C to T, chromosome 13 at 56,546,847 bp (GRCm38)
  • A to T, chromosome 13 at 74,182,166 bp (GRCm38)
  • T to A, chromosome 13 at 74,363,877 bp (GRCm38)
  • T to A, chromosome 13 at 119,828,388 bp (GRCm38)
  • A to C, chromosome 14 at 55,973,799 bp (GRCm38)
  • A to G, chromosome 14 at 60,753,854 bp (GRCm38)
  • A to G, chromosome 14 at 61,203,243 bp (GRCm38)
  • A to T, chromosome 14 at 84,447,962 bp (GRCm38)
  • C to A, chromosome 15 at 28,327,879 bp (GRCm38)
  • A to T, chromosome 15 at 78,904,473 bp (GRCm38)
  • A to G, chromosome 17 at 5,334,987 bp (GRCm38)
  • G to A, chromosome 17 at 32,671,184 bp (GRCm38)
  • G to A, chromosome 17 at 46,687,601 bp (GRCm38)
  • A to T, chromosome 17 at 86,498,733 bp (GRCm38)
  • C to T, chromosome 18 at 4,349,141 bp (GRCm38)
  • A to T, chromosome 18 at 74,304,969 bp (GRCm38)
  • C to A, chromosome 19 at 7,681,854 bp (GRCm38)
  • T to A, chromosome 19 at 59,301,394 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9548 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069344-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.