Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9548Btlr/Mmmh
Stock Number:
069344-MU
Citation ID:
RRID:MMRRC_069344-MU
Other Names:
R9548 (G1)
Major Collection:

Strain Information

Ifng
Name: interferon gamma
Synonyms: IFN-gamma, Ifg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15978
VEGA: 10
HGNC: HGNC:5438
Homologene: 55526
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Fis1
Name: fission, mitochondrial 1
Synonyms: 2010003O14Rik, Ttc11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66437
Homologene: 41099
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 72,632,840 bp (GRCm38)
  • C to A, chromosome 1 at 106,712,778 bp (GRCm38)
  • A to T, chromosome 2 at 58,151,129 bp (GRCm38)
  • T to C, chromosome 2 at 76,743,347 bp (GRCm38)
  • A to T, chromosome 2 at 87,810,753 bp (GRCm38)
  • A to T, chromosome 2 at 87,857,696 bp (GRCm38)
  • T to C, chromosome 2 at 90,281,647 bp (GRCm38)
  • A to T, chromosome 2 at 102,831,487 bp (GRCm38)
  • A to T, chromosome 3 at 51,856,370 bp (GRCm38)
  • C to A, chromosome 4 at 45,058,970 bp (GRCm38)
  • T to C, chromosome 4 at 48,663,956 bp (GRCm38)
  • T to A, chromosome 4 at 96,003,571 bp (GRCm38)
  • T to G, chromosome 4 at 112,419,149 bp (GRCm38)
  • T to C, chromosome 4 at 156,217,833 bp (GRCm38)
  • A to G, chromosome 5 at 5,740,700 bp (GRCm38)
  • G to A, chromosome 5 at 9,440,859 bp (GRCm38)
  • T to C, chromosome 5 at 101,885,193 bp (GRCm38)
  • C to T, chromosome 5 at 114,361,093 bp (GRCm38)
  • A to T, chromosome 5 at 136,963,053 bp (GRCm38)
  • C to T, chromosome 5 at 137,403,061 bp (GRCm38)
  • G to A, chromosome 7 at 26,267,309 bp (GRCm38)
  • A to G, chromosome 7 at 27,129,745 bp (GRCm38)
  • C to T, chromosome 7 at 30,481,450 bp (GRCm38)
  • A to T, chromosome 7 at 99,925,483 bp (GRCm38)
  • A to T, chromosome 7 at 108,423,209 bp (GRCm38)
  • A to T, chromosome 7 at 108,565,127 bp (GRCm38)
  • C to A, chromosome 7 at 141,867,911 bp (GRCm38)
  • A to T, chromosome 8 at 27,124,595 bp (GRCm38)
  • A to T, chromosome 8 at 95,756,226 bp (GRCm38)
  • G to T, chromosome 9 at 56,206,633 bp (GRCm38)
  • C to A, chromosome 9 at 107,955,900 bp (GRCm38)
  • T to A, chromosome 10 at 40,584,869 bp (GRCm38)
  • T to C, chromosome 10 at 81,277,999 bp (GRCm38)
  • C to A, chromosome 10 at 118,441,223 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • T to G, chromosome 10 at 127,552,864 bp (GRCm38)
  • C to A, chromosome 11 at 5,717,622 bp (GRCm38)
  • A to T, chromosome 11 at 20,308,041 bp (GRCm38)
  • A to G, chromosome 11 at 60,753,942 bp (GRCm38)
  • A to T, chromosome 11 at 61,546,162 bp (GRCm38)
  • G to A, chromosome 11 at 72,750,179 bp (GRCm38)
  • G to T, chromosome 11 at 98,180,058 bp (GRCm38)
  • T to C, chromosome 11 at 115,117,032 bp (GRCm38)
  • T to G, chromosome 12 at 17,416,143 bp (GRCm38)
  • T to C, chromosome 12 at 69,198,002 bp (GRCm38)
  • T to C, chromosome 12 at 81,504,608 bp (GRCm38)
  • T to A, chromosome 12 at 103,011,236 bp (GRCm38)
  • C to A, chromosome 13 at 24,276,533 bp (GRCm38)
  • C to T, chromosome 13 at 56,546,847 bp (GRCm38)
  • A to T, chromosome 13 at 74,182,166 bp (GRCm38)
  • T to A, chromosome 13 at 74,363,877 bp (GRCm38)
  • T to A, chromosome 13 at 119,828,388 bp (GRCm38)
  • A to C, chromosome 14 at 55,973,799 bp (GRCm38)
  • A to G, chromosome 14 at 60,753,854 bp (GRCm38)
  • A to G, chromosome 14 at 61,203,243 bp (GRCm38)
  • A to T, chromosome 14 at 84,447,962 bp (GRCm38)
  • C to A, chromosome 15 at 28,327,879 bp (GRCm38)
  • A to T, chromosome 15 at 78,904,473 bp (GRCm38)
  • A to G, chromosome 17 at 5,334,987 bp (GRCm38)
  • G to A, chromosome 17 at 32,671,184 bp (GRCm38)
  • G to A, chromosome 17 at 46,687,601 bp (GRCm38)
  • A to T, chromosome 17 at 86,498,733 bp (GRCm38)
  • C to T, chromosome 18 at 4,349,141 bp (GRCm38)
  • A to T, chromosome 18 at 74,304,969 bp (GRCm38)
  • C to A, chromosome 19 at 7,681,854 bp (GRCm38)
  • T to A, chromosome 19 at 59,301,394 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9548 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069344-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.