Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9550Btlr/Mmmh
Stock Number:
069346-MU
Citation ID:
RRID:MMRRC_069346-MU
Other Names:
R9550 (G1)
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Ppm1e
Name: protein phosphatase 1E (PP2C domain containing)
Synonyms: PP2CH, POPX1, B930008A12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320472
Homologene: 22848
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 4632412M04Rik, 1200016K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 52,212,214 bp (GRCm38)
  • T to C, chromosome 1 at 75,498,266 bp (GRCm38)
  • T to A, chromosome 2 at 36,997,125 bp (GRCm38)
  • T to A, chromosome 2 at 129,120,285 bp (GRCm38)
  • A to G, chromosome 2 at 153,134,731 bp (GRCm38)
  • AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG to AGCAGCAGTGGTGGAGG, chromosome 2 at 154,863,834 bp (GRCm38)
  • T to C, chromosome 2 at 167,980,887 bp (GRCm38)
  • T to C, chromosome 3 at 5,399,512 bp (GRCm38)
  • C to T, chromosome 4 at 116,804,719 bp (GRCm38)
  • A to G, chromosome 4 at 121,146,423 bp (GRCm38)
  • T to C, chromosome 4 at 134,131,287 bp (GRCm38)
  • G to T, chromosome 4 at 136,938,586 bp (GRCm38)
  • T to C, chromosome 4 at 141,767,747 bp (GRCm38)
  • C to T, chromosome 4 at 152,131,077 bp (GRCm38)
  • G to T, chromosome 5 at 35,039,321 bp (GRCm38)
  • A to G, chromosome 5 at 136,311,533 bp (GRCm38)
  • G to T, chromosome 6 at 67,896,215 bp (GRCm38)
  • A to T, chromosome 6 at 92,901,448 bp (GRCm38)
  • G to A, chromosome 6 at 124,628,294 bp (GRCm38)
  • A to T, chromosome 7 at 18,992,320 bp (GRCm38)
  • A to G, chromosome 7 at 73,469,691 bp (GRCm38)
  • T to C, chromosome 7 at 79,598,548 bp (GRCm38)
  • C to T, chromosome 7 at 141,754,505 bp (GRCm38)
  • A to G, chromosome 7 at 143,799,878 bp (GRCm38)
  • C to T, chromosome 8 at 22,243,010 bp (GRCm38)
  • A to G, chromosome 8 at 43,569,083 bp (GRCm38)
  • T to C, chromosome 8 at 95,328,397 bp (GRCm38)
  • T to C, chromosome 9 at 5,328,465 bp (GRCm38)
  • T to C, chromosome 9 at 20,499,186 bp (GRCm38)
  • T to C, chromosome 9 at 38,877,641 bp (GRCm38)
  • T to C, chromosome 9 at 57,089,484 bp (GRCm38)
  • T to A, chromosome 10 at 90,576,498 bp (GRCm38)
  • A to T, chromosome 11 at 87,231,093 bp (GRCm38)
  • A to T, chromosome 11 at 101,981,842 bp (GRCm38)
  • A to G, chromosome 12 at 3,718,437 bp (GRCm38)
  • T to C, chromosome 12 at 28,711,986 bp (GRCm38)
  • A to G, chromosome 13 at 35,816,164 bp (GRCm38)
  • A to G, chromosome 14 at 75,583,163 bp (GRCm38)
  • A to G, chromosome 15 at 78,973,877 bp (GRCm38)
  • T to C, chromosome 15 at 90,569,557 bp (GRCm38)
  • T to A, chromosome 17 at 3,509,431 bp (GRCm38)
  • T to C, chromosome 17 at 36,031,820 bp (GRCm38)
  • T to A, chromosome 17 at 70,786,907 bp (GRCm38)
  • A to T, chromosome 18 at 36,994,346 bp (GRCm38)
  • A to T, chromosome 19 at 8,217,860 bp (GRCm38)
  • A to G, chromosome 19 at 46,397,236 bp (GRCm38)
  • G to A, chromosome 19 at 53,245,090 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9550 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069346-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.