Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9556Btlr/Mmmh
Stock Number:
069351-MU
Citation ID:
RRID:MMRRC_069351-MU
Other Names:
R9556 (G1)
Major Collection:

Strain Information

Nr5a2
Name: nuclear receptor subfamily 5, group A, member 2
Synonyms: Ftf, LRH-1, D1Ertd308e, UF2-H3B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26424
HGNC: HGNC:7984
Homologene: 20827
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Zfp516
Name: zinc finger protein 516
Synonyms: C330029B10Rik, Zfp26l
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329003
VEGA: 18
Homologene: 37122
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108907
Homologene: 10207
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Zfp719
Name: zinc finger protein 719
Synonyms: C630016O21Rik, mszf6, 9430094P17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210105
Zfp160
Name: zinc finger protein 160
Synonyms: 6720480D16Rik, 6720480D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224585
VEGA: 17
Homologene: 137372
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Tes
Name: testin LIM domain protein
Synonyms: Tes2, Tes1, testin2, testin, D6Ertd352e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21753
Homologene: 41051
Mpdz
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: MUPP1, B930003D11Rik, multiple PDZ domain protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Ncbp2
Name: nuclear cap binding protein subunit 2
Synonyms: 20kDa
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68092
Homologene: 56377
Ddx11
Name: DEAD/H box helicase 11
Synonyms: CHLR1, KRG2, CHL1, 4732462I11Rik, essa15a, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Agtr1a
Name: angiotensin II receptor, type 1a
Synonyms: AT1a, Angtr-1a, Agtr-1a, AT1, Agtr1a, 1810074K20Rik, Agt1ar
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11607
HGNC: HGNC:336
Homologene: 3556
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: MJAM, OATP-D, 5830414C08Rik, Anr1, Slc21a11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Izumo3
Name: IZUMO family member 3
Synonyms: 1700011H22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69314
Homologene: 122080
Ddb2
Name: damage specific DNA binding protein 2
Synonyms: p48, 2610043A19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107986
HGNC: HGNC:2718
Homologene: 83
Acp3
Name: acid phosphatase 3
Synonyms: PAP, A030005E02Rik, Acpp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56318
HGNC: HGNC:125
Homologene: 55552
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Or5b99
Name: olfactory receptor family 5 subfamily B member 99
Synonyms: GA_x6K02T2RE5P-3328502-3329434, MOR202-1, Olfr1451
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258700
HGNC: HGNC:8323
Homologene: 128082
Or7e176
Name: olfactory receptor family 7 subfamily E member 176
Synonyms: GA_x6K02T2PVTD-13999915-14000844, MOR145-3, Olfr872
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258553
HGNC: HGNC:8396
Homologene: 138312
Igsf21
Name: immunoglobulin superfamily, member 21
Synonyms: LOC230868
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230868
Homologene: 13153
Slc26a1
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231583
Homologene: 32539
Scgb3a2
Name: secretoglobin, family 3A, member 2
Synonyms: UGRP1, LuLeu1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 117158
Homologene: 14274
Apmap
Name: adipocyte plasma membrane associated protein
Synonyms: 2310001A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71881
Homologene: 41380
Slc35a3
Name: solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms: 2310050P13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229782
Homologene: 40826
Ghdc
Name: GH3 domain containing
Synonyms: D11Lgp1e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80860
Homologene: 32760
Gm7347
Name: predicted gene 7347
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 664804
Homologene: 69402
Hoxa1
Name: homeobox A1
Synonyms: ERA1, early retinoic acid, Hox-1.6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15394
HGNC: HGNC:5099
Homologene: 4032
Ppp1r14a
Name: protein phosphatase 1, regulatory inhibitor subunit 14A
Synonyms: 1110001M11Rik, Cpi17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68458
Homologene: 12267
Ugt2a2
Name: UDP glucuronosyltransferase 2 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 552899
Homologene: 115736
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Eif1ad18
Name: eukaryotic translation initiation factor 1A domain containing 18
Synonyms: Gm16368
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039226
HGNC: HGNC:3252
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 136,890,722 bp (GRCm38)
  • G to T, chromosome 2 at 91,234,857 bp (GRCm38)
  • A to G, chromosome 2 at 119,648,963 bp (GRCm38)
  • A to C, chromosome 2 at 150,587,115 bp (GRCm38)
  • C to A, chromosome 3 at 63,364,804 bp (GRCm38)
  • T to A, chromosome 3 at 116,681,114 bp (GRCm38)
  • A to T, chromosome 4 at 6,408,637 bp (GRCm38)
  • A to T, chromosome 4 at 81,360,026 bp (GRCm38)
  • A to T, chromosome 4 at 92,146,880 bp (GRCm38)
  • A to C, chromosome 4 at 140,034,703 bp (GRCm38)
  • G to A, chromosome 5 at 26,054,998 bp (GRCm38)
  • G to A, chromosome 5 at 87,461,962 bp (GRCm38)
  • T to C, chromosome 5 at 108,672,538 bp (GRCm38)
  • A to T, chromosome 6 at 17,096,234 bp (GRCm38)
  • ATGGTGGTGGTGGTGGTGGTGGTGGTGG to ATGGTGGTGGTGGTGGTGGTGGTGG, chromosome 6 at 52,158,003 bp (GRCm38)
  • C to T, chromosome 6 at 142,428,651 bp (GRCm38)
  • A to G, chromosome 7 at 29,289,519 bp (GRCm38)
  • G to A, chromosome 7 at 43,589,648 bp (GRCm38)
  • A to T, chromosome 7 at 74,552,157 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • A to C, chromosome 8 at 25,858,126 bp (GRCm38)
  • TAGCAGCAGCAGCAGCAGCAGCAGC to TAGCAGCAGCAGCAGCAGCAGC, chromosome 8 at 105,888,435 bp (GRCm38)
  • A to G, chromosome 8 at 109,940,126 bp (GRCm38)
  • A to G, chromosome 9 at 18,658,638 bp (GRCm38)
  • G to T, chromosome 9 at 20,260,355 bp (GRCm38)
  • A to T, chromosome 9 at 104,319,979 bp (GRCm38)
  • A to T, chromosome 11 at 100,768,035 bp (GRCm38)
  • G to A, chromosome 11 at 121,576,227 bp (GRCm38)
  • G to A, chromosome 12 at 88,083,740 bp (GRCm38)
  • A to T, chromosome 13 at 30,381,090 bp (GRCm38)
  • T to C, chromosome 15 at 59,346,867 bp (GRCm38)
  • T to A, chromosome 16 at 31,956,940 bp (GRCm38)
  • A to G, chromosome 17 at 21,026,769 bp (GRCm38)
  • A to G, chromosome 17 at 66,140,212 bp (GRCm38)
  • T to A, chromosome 18 at 43,766,974 bp (GRCm38)
  • C to A, chromosome 18 at 82,956,840 bp (GRCm38)
  • T to C, chromosome 19 at 12,999,574 bp (GRCm38)
  • T to C, chromosome 19 at 20,623,392 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9556 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069351-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.