Strain Name:
C57BL/6J-MtgxR9558Btlr/Mmmh
Stock Number:
069353-MU
Citation ID:
RRID:MMRRC_069353-MU
Other Names:
R9558 (G1)
Major Collection:

Strain Information

Bdnf
Name: brain derived neurotrophic factor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12064
HGNC: HGNC:1033
Homologene: 7245
Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CCR2A, CKR2A, CCR2B, Cmkbr2, CKR2, CC-CKR-2, CKR2B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: jumonji, Jmj
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Nudc
Name: nudC nuclear distribution protein
Synonyms: NudC, Silg92
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18221
HGNC: HGNC:8045
Homologene: 4812
Ddx23
Name: DEAD box helicase 23
Synonyms: 3110082M05Rik, 4921506D17Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: PARP7, DDF1, PARP-7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Mfap4
Name: microfibrillar-associated protein 4
Synonyms: 1110007F23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76293
HGNC: HGNC:7035
Homologene: 134529
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: Listerin, Zfp294, Rnf160, 4930528H02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Ccnk
Name: cyclin K
Synonyms: CycK, CPR4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12454
VEGA: 12
HGNC: HGNC:1596
Homologene: 14748
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: KMT2H, E430018P19Rik, chromatin remodeling factor, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Nufip1
Name: nuclear FMR1 interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27275
VEGA: 14
HGNC: HGNC:8057
Homologene: 8216
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: E130209G04Rik, 9930021A08Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: 2510012P17Rik, Ndap7, 4930534E15Rik, NDAP, CGI-06
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Zc3hav1
Name: zinc finger CCCH type, antiviral 1
Synonyms: 2900058M19Rik, 9130009D18Rik, 9830115L13Rik, ZAP, 1200014N16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78781
Homologene: 10585
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Mapre2
Name: microtubule-associated protein, RP/EB family, member 2
Synonyms: RP1, C820009F03Rik, D18Abb1e, EB2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 212307
HGNC: HGNC:6891
Homologene: 134539
2610028H24Rik
Name: RIKEN cDNA 2610028H24 gene
Synonyms: ORF67
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76964
HGNC: HGNC:1300
Homologene: 50540
Il1r2
Name: interleukin 1 receptor, type II
Synonyms: IL-1 receptor beta chain, CD121b, Il1r-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16178
HGNC: HGNC:5994
Homologene: 7783
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Vmn1r69
Name: vomeronasal 1 receptor 69
Synonyms: V1re9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252904
Homologene: 120153
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: A530084A17Rik, Myhs-f, MYHC-IIX, myosin heavy chain 2X, IId, IId/x, MyHC-IId/x, Myhsf2, Myhs-f2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhse, Myhs-e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Trip6
Name: thyroid hormone receptor interactor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22051
Homologene: 37757
Cyp2d40
Name: cytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms: 1300013D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71754
VEGA: 15
Homologene: 135470
Pcdh8
Name: protocadherin 8
Synonyms: 1700080P15Rik, Papc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18530
HGNC: HGNC:8660
Homologene: 1943
Ogn
Name: osteoglycin
Synonyms: mimican, OG, 3110079A16Rik, mimecan, SLRR3A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18295
VEGA: 13
HGNC: HGNC:8126
Homologene: 8542
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: Unc84a, 4632417G13Rik, 5730434D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77053
Homologene: 11544
Tmf1
Name: TATA element modulatory factor 1
Synonyms: LOC232286, 7030402D04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232286
Homologene: 133801
Ube2q1
Name: ubiquitin-conjugating enzyme E2Q family member 1
Synonyms: PRO3094, NICE-5, 2310012M18Rik, 1110002C01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70093
Homologene: 9730
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: Ccdc129, D530004J12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Tbc1d31
Name: TBC1 domain family, member 31
Synonyms: Wdr67, LOC210544, D330013L20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210544
Homologene: 17089
Pdzrn4
Name: PDZ domain containing RING finger 4
Synonyms: SAMCAP3L, LNX4, 1110017D07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239618
VEGA: 15
Homologene: 85433
Mterf1a
Name: mitochondrial transcription termination factor 1a
Synonyms: Mterf, 9230106K09Rik, Mterf1, 4931431L11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545725
Homologene: 5073
Ndufa8
Name: NADH:ubiquinone oxidoreductase subunit A8
Synonyms: 0610033L03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68375
HGNC: HGNC:7692
Homologene: 40932
Fbxw17
Name: F-box and WD-40 domain protein 17
Synonyms: 1110064L07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109082
Homologene: 82571
Or52n5
Name: olfactory receptor family 52 subfamily N member 5
Synonyms: MOR34-6, GA_x6K02T2PBJ9-7567376-7568329, Olfr669
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259045
Homologene: 72057
Cd38
Name: CD38 antigen
Synonyms: Cd38-rs1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12494
HGNC: HGNC:1667
Homologene: 1345
Adh7
Name: alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
Synonyms: Adh-3t, Adt-1, Adh4, Adh-3, Adh3-t, IV ADH, Adh3, Adh3-e, Adh-3e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11529
HGNC: HGNC:256
Homologene: 37333
Cyp11b1
Name: cytochrome P450, family 11, subfamily b, polypeptide 1
Synonyms: Cyp11b-1, Cyp11b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110115
Homologene: 106948
Smok2b
Name: sperm motility kinase 2B
Synonyms: LOC236574
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 236574
Homologene: 128738
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: D2Ertd120e, WIP, Waspip
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Gjb6
Name: gap junction protein, beta 6
Synonyms: D14Bwg0506e, Cx30, connexin 30
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14623
HGNC: HGNC:4288
Homologene: 4936
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 40,123,262 bp (GRCm38)
  • A to G, chromosome 2 at 36,036,593 bp (GRCm38)
  • C to A, chromosome 2 at 73,437,676 bp (GRCm38)
  • T to C, chromosome 2 at 109,709,654 bp (GRCm38)
  • T to C, chromosome 2 at 130,775,740 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • C to T, chromosome 3 at 65,531,431 bp (GRCm38)
  • A to G, chromosome 3 at 88,982,214 bp (GRCm38)
  • A to G, chromosome 3 at 89,779,459 bp (GRCm38)
  • T to A, chromosome 3 at 138,226,282 bp (GRCm38)
  • G to A, chromosome 4 at 133,533,465 bp (GRCm38)
  • C to T, chromosome 5 at 3,891,807 bp (GRCm38)
  • A to G, chromosome 5 at 43,900,450 bp (GRCm38)
  • A to G, chromosome 5 at 137,310,813 bp (GRCm38)
  • A to G, chromosome 5 at 139,225,264 bp (GRCm38)
  • T to C, chromosome 6 at 38,354,107 bp (GRCm38)
  • T to A, chromosome 6 at 55,967,984 bp (GRCm38)
  • C to T, chromosome 6 at 97,170,332 bp (GRCm38)
  • C to A, chromosome 6 at 124,320,512 bp (GRCm38)
  • T to A, chromosome 7 at 10,580,258 bp (GRCm38)
  • C to G, chromosome 7 at 29,172,548 bp (GRCm38)
  • T to C, chromosome 7 at 104,939,408 bp (GRCm38)
  • T to C, chromosome 9 at 53,500,781 bp (GRCm38)
  • C to T, chromosome 9 at 110,547,560 bp (GRCm38)
  • T to A, chromosome 9 at 124,106,067 bp (GRCm38)
  • C to T, chromosome 10 at 76,454,742 bp (GRCm38)
  • C to T, chromosome 11 at 11,801,778 bp (GRCm38)
  • A to C, chromosome 11 at 61,486,139 bp (GRCm38)
  • T to A, chromosome 11 at 67,092,490 bp (GRCm38)
  • C to G, chromosome 11 at 67,217,792 bp (GRCm38)
  • A to T, chromosome 12 at 108,189,138 bp (GRCm38)
  • C to T, chromosome 13 at 44,914,777 bp (GRCm38)
  • A to G, chromosome 13 at 49,611,307 bp (GRCm38)
  • T to C, chromosome 13 at 50,423,275 bp (GRCm38)
  • A to G, chromosome 14 at 44,338,557 bp (GRCm38)
  • G to A, chromosome 14 at 57,124,804 bp (GRCm38)
  • A to G, chromosome 14 at 76,111,041 bp (GRCm38)
  • A to G, chromosome 14 at 79,768,940 bp (GRCm38)
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp (GRCm38)
  • G to A, chromosome 15 at 57,932,592 bp (GRCm38)
  • T to C, chromosome 15 at 74,838,940 bp (GRCm38)
  • T to C, chromosome 15 at 82,761,466 bp (GRCm38)
  • A to G, chromosome 15 at 92,401,996 bp (GRCm38)
  • A to G, chromosome 15 at 98,647,552 bp (GRCm38)
  • A to T, chromosome 16 at 87,423,407 bp (GRCm38)
  • G to A, chromosome 17 at 13,234,997 bp (GRCm38)
  • A to G, chromosome 17 at 46,951,917 bp (GRCm38)
  • A to T, chromosome 17 at 58,364,162 bp (GRCm38)
  • A to G, chromosome 17 at 67,817,009 bp (GRCm38)
  • T to A, chromosome 18 at 23,858,138 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9558 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069353-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.