Strain Name:
C57BL/6J-MtgxR9559Btlr/Mmmh
Stock Number:
069354-MU
Citation ID:
RRID:MMRRC_069354-MU
Other Names:
R9559 (G1)
Major Collection:

Strain Information

Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: WSTF, Wbscr9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Grb10
Name: growth factor receptor bound protein 10
Synonyms: Meg1, 5730571D09Rik, maternally expressed gene 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14783
HGNC: HGNC:4564
Homologene: 3882
Cyb5r3
Name: cytochrome b5 reductase 3
Synonyms: Dia1, 2500002N19Rik, Dia-1, 0610016L08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109754
HGNC: HGNC:2873
Homologene: 47921
Kif26a
Name: kinesin family member 26A
Synonyms: N-11 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668303
Homologene: 18970
Gmeb1
Name: glucocorticoid modulatory element binding protein 1
Synonyms: 1110050A04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56809
HGNC: HGNC:4370
Homologene: 10647
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Ten-m4, l7Rn3, Odz4, l(7)-3Rn, ELM2, Doc4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: A930014J19Rik, DMPK-like
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Fcer1a
Name: Fc receptor, IgE, high affinity I, alpha polypeptide
Synonyms: Fcr-5, Fce1a, FcERI
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14125
HGNC: HGNC:3609
Homologene: 1516
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 9830132G07Rik, 8430415N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Or5ak24
Name: olfactory receptor family 5 subfamily AK member 24
Synonyms: Olfr994, MOR203-4, GA_x6K02T2Q125-46907515-46906571
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258425
Homologene: 17245
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Gucy1b1
Name: guanylate cyclase 1, soluble, beta 1
Synonyms: Gucy1b3, beta 1 sGC
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54195
HGNC: HGNC:4687
Homologene: 664
Scyl3
Name: SCY1-like 3 (S. cerevisiae)
Synonyms: Pace1, 1200016D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240880
Homologene: 10706
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Vmn1r61
Name: vomeronasal 1 receptor 61
Synonyms: Gm7186
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636731
Homologene: 41799
Hdgfl1
Name: HDGF like 1
Synonyms: Pwwp1, Hdgfrp1, HRP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15192
Homologene: 56406
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Mterf1a
Name: mitochondrial transcription termination factor 1a
Synonyms: Mterf, Mterf1, 4931431L11Rik, 9230106K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545725
Homologene: 5073
Prb1a
Name: proline-rich protein BstNI subfamily 1A
Synonyms: Prb1, proline-rich proteoglycan 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381833
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: Grb4, 4833426I10Rik, NCKbeta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Gimap9
Name: GTPase, IMAP family member 9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 317758
Homologene: 115637
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: TULA-2, Sts-1, 2810457I06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72828
Homologene: 13152
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il18ralpha, Il1rrp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Krtcap2
Name: keratinocyte associated protein 2
Synonyms: 0610010I12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66059
Homologene: 15494
Zfp112
Name: zinc finger protein 112
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57745
Homologene: 49338
Or2h2c
Name: olfactory receptor family 2 subfamily H member 2C
Synonyms: MOR256-29, Olfr92, GA_x6K02T2PSCP-1552066-1551128
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258448
HGNC: HGNC:8253
Homologene: 115562
C130073F10Rik
Name: RIKEN cDNA C130073F10 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242574
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Or7e173
Name: olfactory receptor family 7 subfamily E member 173
Synonyms: MOR145-5, GA_x6K02T2PVTD-13768406-13767468, Olfr866
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258551
HGNC: HGNC:8396
Homologene: 133687
Scgn
Name: secretagogin, EF-hand calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214189
Homologene: 5088
Mettl17
Name: methyltransferase like 17
Synonyms: Mett11d1, 2310032K15Rik, D14Ertd209e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52535
Homologene: 11226
Prl3d1
Name: prolactin family 3, subfamily d, member 1
Synonyms: Pl1, mPL-I, placental lactogen 1, PL-Ia, prolactin-like 2, Csh1, Pl-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18775
Homologene: 137215
Or5ac24
Name: olfactory receptor family 5 subfamily AC member 24
Synonyms: MOR182-4, Olfr206, GA_x54KRFPKG5P-55560552-55559632
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258993
Homologene: 74262
Asb14
Name: ankyrin repeat and SOCS box-containing 14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 142687
Homologene: 15445
Slc22a12
Name: solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms: Rst, URAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20521
Homologene: 56442
Bbc3
Name: BCL2 binding component 3
Synonyms: PUMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170770
Homologene: 8679
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 40,489,633 bp (GRCm38)
  • T to C, chromosome 1 at 43,554,047 bp (GRCm38)
  • A to T, chromosome 1 at 139,430,315 bp (GRCm38)
  • G to T, chromosome 1 at 140,102,537 bp (GRCm38)
  • T to C, chromosome 1 at 163,952,204 bp (GRCm38)
  • T to G, chromosome 1 at 173,225,317 bp (GRCm38)
  • G to A, chromosome 1 at 180,111,894 bp (GRCm38)
  • A to C, chromosome 2 at 85,430,409 bp (GRCm38)
  • T to A, chromosome 3 at 82,039,747 bp (GRCm38)
  • C to T, chromosome 3 at 89,246,871 bp (GRCm38)
  • A to G, chromosome 3 at 104,800,961 bp (GRCm38)
  • T to A, chromosome 4 at 101,890,749 bp (GRCm38)
  • G to T, chromosome 4 at 128,544,768 bp (GRCm38)
  • A to C, chromosome 4 at 132,225,829 bp (GRCm38)
  • C to T, chromosome 5 at 3,891,807 bp (GRCm38)
  • T to A, chromosome 5 at 135,187,678 bp (GRCm38)
  • A to T, chromosome 6 at 48,678,200 bp (GRCm38)
  • G to A, chromosome 6 at 132,207,425 bp (GRCm38)
  • A to G, chromosome 7 at 5,610,499 bp (GRCm38)
  • T to C, chromosome 7 at 16,313,735 bp (GRCm38)
  • G to T, chromosome 7 at 24,126,683 bp (GRCm38)
  • T to A, chromosome 7 at 96,823,849 bp (GRCm38)
  • A to T, chromosome 7 at 120,051,728 bp (GRCm38)
  • G to A, chromosome 7 at 120,421,796 bp (GRCm38)
  • A to G, chromosome 7 at 125,632,855 bp (GRCm38)
  • A to T, chromosome 7 at 144,031,304 bp (GRCm38)
  • A to G, chromosome 9 at 20,027,920 bp (GRCm38)
  • G to A, chromosome 9 at 41,043,630 bp (GRCm38)
  • A to G, chromosome 9 at 108,957,292 bp (GRCm38)
  • C to T, chromosome 10 at 77,077,796 bp (GRCm38)
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp (GRCm38)
  • C to A, chromosome 11 at 11,945,535 bp (GRCm38)
  • T to C, chromosome 11 at 86,722,260 bp (GRCm38)
  • C to T, chromosome 12 at 112,175,570 bp (GRCm38)
  • C to T, chromosome 12 at 112,786,162 bp (GRCm38)
  • A to G, chromosome 13 at 23,953,938 bp (GRCm38)
  • C to T, chromosome 13 at 26,769,256 bp (GRCm38)
  • C to T, chromosome 13 at 27,096,487 bp (GRCm38)
  • C to T, chromosome 13 at 44,914,777 bp (GRCm38)
  • T to C, chromosome 14 at 26,915,095 bp (GRCm38)
  • G to A, chromosome 14 at 51,891,552 bp (GRCm38)
  • A to G, chromosome 15 at 6,852,546 bp (GRCm38)
  • A to G, chromosome 15 at 58,557,910 bp (GRCm38)
  • C to A, chromosome 15 at 83,158,922 bp (GRCm38)
  • C to A, chromosome 16 at 59,345,005 bp (GRCm38)
  • C to T, chromosome 17 at 37,111,617 bp (GRCm38)
  • T to C, chromosome 17 at 56,386,228 bp (GRCm38)
  • A to G, chromosome 17 at 84,591,589 bp (GRCm38)
  • A to T, chromosome 18 at 61,507,196 bp (GRCm38)
  • T to A, chromosome 19 at 6,537,656 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9559 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069354-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.