Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9559Btlr/Mmmh
Stock Number:
069354-MU
Citation ID:
RRID:MMRRC_069354-MU
Other Names:
R9559 (G1)
Major Collection:

Strain Information

Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 40,489,633 bp (GRCm38)
  • T to C, chromosome 1 at 43,554,047 bp (GRCm38)
  • A to T, chromosome 1 at 139,430,315 bp (GRCm38)
  • G to T, chromosome 1 at 140,102,537 bp (GRCm38)
  • T to C, chromosome 1 at 163,952,204 bp (GRCm38)
  • T to G, chromosome 1 at 173,225,317 bp (GRCm38)
  • G to A, chromosome 1 at 180,111,894 bp (GRCm38)
  • A to C, chromosome 2 at 85,430,409 bp (GRCm38)
  • T to A, chromosome 3 at 82,039,747 bp (GRCm38)
  • C to T, chromosome 3 at 89,246,871 bp (GRCm38)
  • A to G, chromosome 3 at 104,800,961 bp (GRCm38)
  • T to A, chromosome 4 at 101,890,749 bp (GRCm38)
  • G to T, chromosome 4 at 128,544,768 bp (GRCm38)
  • A to C, chromosome 4 at 132,225,829 bp (GRCm38)
  • C to T, chromosome 5 at 3,891,807 bp (GRCm38)
  • T to A, chromosome 5 at 135,187,678 bp (GRCm38)
  • A to T, chromosome 6 at 48,678,200 bp (GRCm38)
  • G to A, chromosome 6 at 132,207,425 bp (GRCm38)
  • A to G, chromosome 7 at 5,610,499 bp (GRCm38)
  • T to C, chromosome 7 at 16,313,735 bp (GRCm38)
  • G to T, chromosome 7 at 24,126,683 bp (GRCm38)
  • T to A, chromosome 7 at 96,823,849 bp (GRCm38)
  • A to T, chromosome 7 at 120,051,728 bp (GRCm38)
  • G to A, chromosome 7 at 120,421,796 bp (GRCm38)
  • A to G, chromosome 7 at 125,632,855 bp (GRCm38)
  • A to T, chromosome 7 at 144,031,304 bp (GRCm38)
  • A to G, chromosome 9 at 20,027,920 bp (GRCm38)
  • G to A, chromosome 9 at 41,043,630 bp (GRCm38)
  • A to G, chromosome 9 at 108,957,292 bp (GRCm38)
  • C to T, chromosome 10 at 77,077,796 bp (GRCm38)
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp (GRCm38)
  • C to A, chromosome 11 at 11,945,535 bp (GRCm38)
  • T to C, chromosome 11 at 86,722,260 bp (GRCm38)
  • C to T, chromosome 12 at 112,175,570 bp (GRCm38)
  • C to T, chromosome 12 at 112,786,162 bp (GRCm38)
  • A to G, chromosome 13 at 23,953,938 bp (GRCm38)
  • C to T, chromosome 13 at 26,769,256 bp (GRCm38)
  • C to T, chromosome 13 at 27,096,487 bp (GRCm38)
  • C to T, chromosome 13 at 44,914,777 bp (GRCm38)
  • T to C, chromosome 14 at 26,915,095 bp (GRCm38)
  • G to A, chromosome 14 at 51,891,552 bp (GRCm38)
  • A to G, chromosome 15 at 6,852,546 bp (GRCm38)
  • A to G, chromosome 15 at 58,557,910 bp (GRCm38)
  • C to A, chromosome 15 at 83,158,922 bp (GRCm38)
  • C to A, chromosome 16 at 59,345,005 bp (GRCm38)
  • C to T, chromosome 17 at 37,111,617 bp (GRCm38)
  • T to C, chromosome 17 at 56,386,228 bp (GRCm38)
  • A to G, chromosome 17 at 84,591,589 bp (GRCm38)
  • A to T, chromosome 18 at 61,507,196 bp (GRCm38)
  • T to A, chromosome 19 at 6,537,656 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9559 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069354-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.