Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9574Btlr/Mmmh
Stock Number:
069367-MU
Citation ID:
RRID:MMRRC_069367-MU
Other Names:
R9574 (G1)
Major Collection:

Strain Information

Kifc2
Name: kinesin family member C2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16581
VEGA: 15
Homologene: 7800
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Cdyl2
Name: chromodomain protein, Y chromosome-like 2
Synonyms: 1700029M19Rik, 4930453I21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75796
Homologene: 41779
Sema3f
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms: Sema IV, Semak
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20350
Homologene: 20885
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 78,665,765 bp (GRCm38)
  • C to A, chromosome 1 at 93,689,225 bp (GRCm38)
  • A to T, chromosome 1 at 152,756,664 bp (GRCm38)
  • A to G, chromosome 2 at 37,332,136 bp (GRCm38)
  • A to G, chromosome 2 at 37,543,234 bp (GRCm38)
  • A to T, chromosome 2 at 52,437,004 bp (GRCm38)
  • T to C, chromosome 2 at 113,595,057 bp (GRCm38)
  • T to C, chromosome 2 at 125,983,059 bp (GRCm38)
  • A to G, chromosome 2 at 127,364,363 bp (GRCm38)
  • A to T, chromosome 2 at 128,751,960 bp (GRCm38)
  • C to T, chromosome 3 at 72,921,157 bp (GRCm38)
  • T to C, chromosome 3 at 79,656,274 bp (GRCm38)
  • T to C, chromosome 3 at 83,961,604 bp (GRCm38)
  • T to C, chromosome 3 at 90,210,386 bp (GRCm38)
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp (GRCm38)
  • T to A, chromosome 4 at 34,839,460 bp (GRCm38)
  • T to A, chromosome 4 at 40,853,766 bp (GRCm38)
  • T to A, chromosome 4 at 119,171,033 bp (GRCm38)
  • T to A, chromosome 4 at 143,270,531 bp (GRCm38)
  • C to T, chromosome 5 at 38,673,430 bp (GRCm38)
  • A to G, chromosome 5 at 44,000,837 bp (GRCm38)
  • A to T, chromosome 5 at 110,834,729 bp (GRCm38)
  • A to T, chromosome 5 at 115,575,282 bp (GRCm38)
  • A to G, chromosome 5 at 118,237,265 bp (GRCm38)
  • T to C, chromosome 6 at 25,775,719 bp (GRCm38)
  • T to A, chromosome 6 at 53,681,054 bp (GRCm38)
  • T to A, chromosome 6 at 83,979,698 bp (GRCm38)
  • T to A, chromosome 6 at 89,663,184 bp (GRCm38)
  • T to C, chromosome 6 at 113,497,626 bp (GRCm38)
  • T to A, chromosome 6 at 134,470,699 bp (GRCm38)
  • T to A, chromosome 7 at 8,150,330 bp (GRCm38)
  • C to A, chromosome 7 at 19,390,135 bp (GRCm38)
  • A to T, chromosome 7 at 26,766,927 bp (GRCm38)
  • G to T, chromosome 7 at 26,766,928 bp (GRCm38)
  • C to T, chromosome 7 at 28,445,934 bp (GRCm38)
  • T to C, chromosome 7 at 28,895,439 bp (GRCm38)
  • C to T, chromosome 7 at 29,876,055 bp (GRCm38)
  • A to G, chromosome 7 at 83,632,736 bp (GRCm38)
  • T to C, chromosome 7 at 85,136,809 bp (GRCm38)
  • A to G, chromosome 7 at 141,891,994 bp (GRCm38)
  • A to T, chromosome 7 at 142,439,466 bp (GRCm38)
  • A to G, chromosome 7 at 144,068,725 bp (GRCm38)
  • T to C, chromosome 8 at 22,074,024 bp (GRCm38)
  • A to G, chromosome 8 at 33,574,481 bp (GRCm38)
  • T to C, chromosome 8 at 95,422,886 bp (GRCm38)
  • T to A, chromosome 8 at 116,623,930 bp (GRCm38)
  • T to G, chromosome 8 at 116,933,410 bp (GRCm38)
  • T to A, chromosome 8 at 125,442,714 bp (GRCm38)
  • A to G, chromosome 9 at 20,638,813 bp (GRCm38)
  • G to A, chromosome 9 at 56,890,058 bp (GRCm38)
  • T to A, chromosome 9 at 77,451,426 bp (GRCm38)
  • T to A, chromosome 9 at 107,689,773 bp (GRCm38)
  • T to A, chromosome 9 at 108,084,854 bp (GRCm38)
  • C to T, chromosome 10 at 20,278,220 bp (GRCm38)
  • A to C, chromosome 10 at 62,507,665 bp (GRCm38)
  • G to A, chromosome 10 at 89,422,273 bp (GRCm38)
  • T to C, chromosome 11 at 48,837,633 bp (GRCm38)
  • T to A, chromosome 11 at 48,947,669 bp (GRCm38)
  • T to C, chromosome 11 at 67,025,267 bp (GRCm38)
  • A to T, chromosome 11 at 102,404,564 bp (GRCm38)
  • T to C, chromosome 13 at 23,535,591 bp (GRCm38)
  • A to T, chromosome 14 at 16,574,858 bp (GRCm38)
  • G to A, chromosome 14 at 52,314,160 bp (GRCm38)
  • C to T, chromosome 14 at 66,037,622 bp (GRCm38)
  • T to C, chromosome 14 at 70,143,656 bp (GRCm38)
  • T to C, chromosome 15 at 76,662,197 bp (GRCm38)
  • T to C, chromosome 15 at 83,616,799 bp (GRCm38)
  • A to G, chromosome 16 at 14,170,481 bp (GRCm38)
  • T to C, chromosome 17 at 26,118,887 bp (GRCm38)
  • G to A, chromosome 17 at 48,264,644 bp (GRCm38)
  • C to T, chromosome 17 at 57,238,039 bp (GRCm38)
  • T to C, chromosome 17 at 88,014,523 bp (GRCm38)
  • A to G, chromosome 18 at 23,832,936 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9574 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069367-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.