Strain Name:
C57BL/6J-MtgxR9575Btlr/Mmmh
Stock Number:
069368-MU
Citation ID:
RRID:MMRRC_069368-MU
Other Names:
R9575 (G1)
Major Collection:

Strain Information

Fastk
Name: Fas-activated serine/threonine kinase
Synonyms: 0610011K02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66587
Homologene: 4884
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Mbtd1
Name: mbt domain containing 1
Synonyms: hemp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103537
Homologene: 41185
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: PRP11, 66kDa, SFA66, Sap62
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Cep350
Name: centrosomal protein 350
Synonyms: 4933409L06Rik, 6430546F08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224171
Homologene: 10842
Zfp866
Name: zinc finger protein 866
Synonyms: D330038O06Rik, 9830167H18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: EFG2, A930009M04Rik, MST027, 6530419G12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320806
Homologene: 6238
Myo9a
Name: myosin IXa
Synonyms: C130068I12Rik, 4732465J09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Spag9
Name: sperm associated antigen 9
Synonyms: 3110018C07Rik, Mapk8ip4, 4831406C20Rik, syd1, JLP, 4733401I23Rik, JIP4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Slitrk3
Name: SLIT and NTRK-like family, member 3
Synonyms: ST3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 386750
Homologene: 8955
Grhl1
Name: grainyhead like transcription factor 1
Synonyms: LBP-32, p61 MGR, p70 MGR, Tcfcp2l2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 195733
VEGA: 12
Homologene: 32219
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: 2610100B16Rik, Odz3, Ten-m3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Plpp4
Name: phospholipid phosphatase 4
Synonyms: C030048B12Rik, LOC381925, Ppapdc1a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381925
Homologene: 38751
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Slc6a9
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Synonyms: Glyt1, Glyt-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14664
Homologene: 5050
Rhbdf1
Name: rhomboid 5 homolog 1
Synonyms: Dist, Egfr-rs, Dist1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13650
Homologene: 32085
Igsf3
Name: immunoglobulin superfamily, member 3
Synonyms: 4833439O17Rik, 2810035F16Rik, 1700016K10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78908
HGNC: HGNC:5950
Homologene: 1182
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Flnc
Name: filamin C, gamma
Synonyms: 1110055E19Rik, actin binding protein 280, Fln2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Or3a10
Name: olfactory receptor family 3 subfamily A member 10
Synonyms: Olfr139, GA_x6K02T2P1NL-4202012-4201065, M5, MOR255-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259005
Homologene: 77386
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: Gm6095, 4921529N20Rik, 4933402B14Rik, Tmem146
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Poglut1
Name: protein O-glucosyltransferase 1
Synonyms: 9630046K23Rik, Ktelc1, wsnp, Rumi
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224143
Homologene: 41353
B4galt4
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms: 9130402O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56375
HGNC: HGNC:927
Homologene: 37848
Zfp971
Name: zinc finger protein 971
Synonyms: Etohi1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 626848
Homologene: 134324
Potefam3b
Name: POTE ankyrin domain family member 3B
Synonyms: Pote3b, Gm21119
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100861668
Homologene: 128726
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 155,875,367 bp (GRCm38)
  • T to A, chromosome 2 at 178,033,510 bp (GRCm38)
  • T to C, chromosome 3 at 64,271,314 bp (GRCm38)
  • C to T, chromosome 3 at 73,048,794 bp (GRCm38)
  • A to G, chromosome 3 at 101,431,309 bp (GRCm38)
  • G to T, chromosome 3 at 132,998,947 bp (GRCm38)
  • T to C, chromosome 4 at 117,857,406 bp (GRCm38)
  • A to G, chromosome 5 at 24,445,069 bp (GRCm38)
  • A to G, chromosome 6 at 29,454,400 bp (GRCm38)
  • T to C, chromosome 7 at 42,612,617 bp (GRCm38)
  • T to A, chromosome 7 at 129,323,487 bp (GRCm38)
  • A to T, chromosome 8 at 20,619,074 bp (GRCm38)
  • A to T, chromosome 8 at 48,235,761 bp (GRCm38)
  • A to T, chromosome 8 at 69,766,638 bp (GRCm38)
  • T to C, chromosome 9 at 59,905,907 bp (GRCm38)
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp (GRCm38)
  • A to G, chromosome 11 at 32,213,101 bp (GRCm38)
  • A to T, chromosome 11 at 74,045,014 bp (GRCm38)
  • G to A, chromosome 11 at 93,908,938 bp (GRCm38)
  • A to G, chromosome 11 at 94,071,583 bp (GRCm38)
  • T to C, chromosome 12 at 24,586,083 bp (GRCm38)
  • T to A, chromosome 12 at 65,105,540 bp (GRCm38)
  • T to C, chromosome 13 at 97,149,398 bp (GRCm38)
  • A to T, chromosome 15 at 9,596,586 bp (GRCm38)
  • T to C, chromosome 16 at 38,542,923 bp (GRCm38)
  • T to C, chromosome 16 at 38,763,151 bp (GRCm38)
  • T to A, chromosome 16 at 49,018,391 bp (GRCm38)
  • A to G, chromosome 17 at 56,628,231 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9575 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069368-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.