Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9604Btlr/Mmmh
Stock Number:
069397-MU
Citation ID:
RRID:MMRRC_069397-MU
Other Names:
R9604 (G1)
Major Collection:

Strain Information

Hcn2
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonyms: HAC1, trls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15166
HGNC: HGNC:4846
Homologene: 31022
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Cep83
Name: centrosomal protein 83
Synonyms: 2600001G24Rik, 5730513H21Rik, 4921537D05Rik, Ccdc41
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77048
VEGA: 10
Homologene: 9396
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: U5-116kD, 116kDa, Snrp116
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Nol6
Name: nucleolar protein family 6 (RNA-associated)
Synonyms: Nrap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230082
Homologene: 41505
Pals2
Name: protein associated with LIN7 2, MAGUK family member
Synonyms: P55t, Pals2, Mpp6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56524
Homologene: 22976
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Atp13a3
Name: ATPase type 13A3
Synonyms: LOC224088, LOC224087, LOC385637
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224088
Homologene: 23455
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Ifitm1
Name: interferon induced transmembrane protein 1
Synonyms: fragilis2, 1110036C17Rik, Mil2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68713
HGNC: HGNC:5412
Homologene: 135938
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Tap1
Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: RING4, PSF-1, MTP1, Tap-1, Ham-1, Ham1, Abcb2, TAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21354
HGNC: HGNC:43
Homologene: 495
Klk11
Name: kallikrein related-peptidase 11
Synonyms: TLSP, hippostasin, Prss20, 2310015I08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56538
HGNC: HGNC:6359
Homologene: 27048
Heatr6
Name: HEAT repeat containing 6
Synonyms: 2700008B19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217026
Homologene: 11116
Pde12
Name: phosphodiesterase 12
Synonyms: E430028B21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211948
Homologene: 14272
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: 2310026J01Rik, Pla2epsilon
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329502
Homologene: 65339
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Ankrd60
Name: ankyrin repeat domain 60
Synonyms: 1700019A24Rik, 1700030G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70065
Homologene: 43792
Dnm3
Name: dynamin 3
Synonyms: B230343F03Rik, 9630020E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Tas2r125
Name: taste receptor, type 2, member 125
Synonyms: Tas2r25, T2R26, mGR25, mt2r59
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387352
Homologene: 87294
Hid1
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217310
Homologene: 12737
Plekhd1
Name: pleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms: 3830431G21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217682
Homologene: 15090
Vmn1r172
Name: vomeronasal 1 receptor 172
Synonyms: V3R9, V1rd9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81010
Homologene: 79577
Tent5a
Name: terminal nucleotidyltransferase 5A
Synonyms: D930050G01Rik, BAP014, Fam46a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212943
Homologene: 23032
Gal3st4
Name: galactose-3-O-sulfotransferase 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330217
Homologene: 11633
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Harbi1
Name: harbinger transposase derived 1
Synonyms: D230010M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241547
Homologene: 24535
Golim4
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73124
Homologene: 8716
N4bp3
Name: NEDD4 binding protein 3
Synonyms: C330016O10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 212706
Homologene: 17124
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 162,011,015 bp (GRCm38)
  • C to T, chromosome 2 at 52,292,668 bp (GRCm38)
  • T to C, chromosome 2 at 91,712,344 bp (GRCm38)
  • C to T, chromosome 2 at 120,185,199 bp (GRCm38)
  • A to T, chromosome 2 at 173,571,194 bp (GRCm38)
  • A to T, chromosome 3 at 75,908,128 bp (GRCm38)
  • A to G, chromosome 4 at 19,555,477 bp (GRCm38)
  • A to G, chromosome 4 at 41,120,298 bp (GRCm38)
  • A to G, chromosome 4 at 101,733,276 bp (GRCm38)
  • T to C, chromosome 4 at 139,432,516 bp (GRCm38)
  • A to G, chromosome 5 at 44,029,733 bp (GRCm38)
  • T to C, chromosome 5 at 109,940,448 bp (GRCm38)
  • T to A, chromosome 5 at 138,265,749 bp (GRCm38)
  • C to A, chromosome 6 at 50,196,617 bp (GRCm38)
  • TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,965 bp (GRCm38)
  • T to C, chromosome 6 at 132,910,060 bp (GRCm38)
  • T to A, chromosome 7 at 10,710,368 bp (GRCm38)
  • T to C, chromosome 7 at 23,659,768 bp (GRCm38)
  • T to A, chromosome 7 at 43,778,426 bp (GRCm38)
  • C to T, chromosome 7 at 140,968,314 bp (GRCm38)
  • G to A, chromosome 8 at 91,304,805 bp (GRCm38)
  • C to A, chromosome 9 at 85,324,624 bp (GRCm38)
  • T to A, chromosome 9 at 95,762,004 bp (GRCm38)
  • A to T, chromosome 10 at 52,118,153 bp (GRCm38)
  • T to C, chromosome 10 at 79,728,953 bp (GRCm38)
  • A to C, chromosome 10 at 94,719,077 bp (GRCm38)
  • A to T, chromosome 11 at 51,645,666 bp (GRCm38)
  • T to C, chromosome 11 at 83,777,362 bp (GRCm38)
  • T to C, chromosome 11 at 102,846,230 bp (GRCm38)
  • A to T, chromosome 11 at 115,352,640 bp (GRCm38)
  • A to G, chromosome 12 at 80,692,957 bp (GRCm38)
  • T to A, chromosome 13 at 55,233,994 bp (GRCm38)
  • A to G, chromosome 14 at 26,668,853 bp (GRCm38)
  • A to G, chromosome 16 at 20,681,505 bp (GRCm38)
  • G to T, chromosome 16 at 30,349,688 bp (GRCm38)
  • A to G, chromosome 16 at 56,777,207 bp (GRCm38)
  • A to C, chromosome 17 at 34,193,198 bp (GRCm38)
  • C to A, chromosome 18 at 78,109,592 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9604 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069397-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.