Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9612Btlr/Mmmh
Stock Number:
069405-MU
Citation ID:
RRID:MMRRC_069405-MU
Other Names:
R9612 (G1)
Major Collection:

Strain Information

Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Cdon
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CAM-related/down-regulated by oncogenes, CDO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Pmp22
Name: peripheral myelin protein 22
Synonyms: Gas-3, TRE002
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Bri3bp
Name: Bri3 binding protein
Synonyms: 2410150I18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76809
Homologene: 50955
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Gpr21
Name: G protein-coupled receptor 21
Synonyms: C230004C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 338346
HGNC: HGNC:4476
Homologene: 74546
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 9,968,842 bp (GRCm38)
  • T to A, chromosome 1 at 72,665,135 bp (GRCm38)
  • T to A, chromosome 1 at 93,025,694 bp (GRCm38)
  • T to C, chromosome 1 at 136,190,975 bp (GRCm38)
  • A to G, chromosome 1 at 163,038,929 bp (GRCm38)
  • T to A, chromosome 1 at 180,894,721 bp (GRCm38)
  • C to A, chromosome 1 at 188,359,866 bp (GRCm38)
  • T to C, chromosome 1 at 189,880,786 bp (GRCm38)
  • T to C, chromosome 2 at 37,518,387 bp (GRCm38)
  • T to A, chromosome 2 at 66,533,364 bp (GRCm38)
  • G to T, chromosome 2 at 104,653,025 bp (GRCm38)
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp (GRCm38)
  • C to A, chromosome 3 at 65,957,983 bp (GRCm38)
  • C to A, chromosome 3 at 81,971,694 bp (GRCm38)
  • T to C, chromosome 3 at 83,270,886 bp (GRCm38)
  • T to A, chromosome 3 at 89,341,940 bp (GRCm38)
  • A to G, chromosome 3 at 89,609,396 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to A, chromosome 3 at 97,581,147 bp (GRCm38)
  • T to A, chromosome 3 at 106,731,884 bp (GRCm38)
  • T to A, chromosome 3 at 116,027,496 bp (GRCm38)
  • T to A, chromosome 3 at 117,321,961 bp (GRCm38)
  • A to G, chromosome 3 at 145,545,205 bp (GRCm38)
  • T to C, chromosome 4 at 35,708,450 bp (GRCm38)
  • A to C, chromosome 4 at 123,117,226 bp (GRCm38)
  • T to A, chromosome 4 at 123,323,336 bp (GRCm38)
  • A to G, chromosome 4 at 126,136,857 bp (GRCm38)
  • G to T, chromosome 5 at 21,330,579 bp (GRCm38)
  • G to T, chromosome 5 at 37,386,786 bp (GRCm38)
  • A to G, chromosome 5 at 48,374,530 bp (GRCm38)
  • T to C, chromosome 5 at 107,593,865 bp (GRCm38)
  • T to C, chromosome 5 at 107,795,712 bp (GRCm38)
  • A to T, chromosome 5 at 120,901,965 bp (GRCm38)
  • T to C, chromosome 5 at 125,454,326 bp (GRCm38)
  • A to T, chromosome 6 at 4,077,918 bp (GRCm38)
  • T to C, chromosome 6 at 33,249,226 bp (GRCm38)
  • T to G, chromosome 6 at 57,652,032 bp (GRCm38)
  • T to A, chromosome 6 at 60,976,424 bp (GRCm38)
  • T to A, chromosome 6 at 68,519,333 bp (GRCm38)
  • G to T, chromosome 6 at 137,414,320 bp (GRCm38)
  • G to A, chromosome 7 at 24,628,947 bp (GRCm38)
  • A to T, chromosome 7 at 25,355,063 bp (GRCm38)
  • A to T, chromosome 7 at 34,248,231 bp (GRCm38)
  • T to C, chromosome 7 at 41,626,903 bp (GRCm38)
  • A to G, chromosome 7 at 108,286,280 bp (GRCm38)
  • T to A, chromosome 8 at 4,628,298 bp (GRCm38)
  • A to T, chromosome 8 at 55,872,083 bp (GRCm38)
  • G to A, chromosome 8 at 70,531,674 bp (GRCm38)
  • G to T, chromosome 8 at 88,670,473 bp (GRCm38)
  • A to G, chromosome 8 at 121,801,178 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • A to G, chromosome 9 at 7,560,607 bp (GRCm38)
  • T to A, chromosome 9 at 19,121,464 bp (GRCm38)
  • A to G, chromosome 9 at 19,375,381 bp (GRCm38)
  • G to A, chromosome 9 at 35,486,905 bp (GRCm38)
  • A to T, chromosome 9 at 119,127,465 bp (GRCm38)
  • A to T, chromosome 10 at 77,265,929 bp (GRCm38)
  • A to C, chromosome 10 at 79,194,878 bp (GRCm38)
  • T to A, chromosome 10 at 82,289,619 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • T to C, chromosome 11 at 22,169,124 bp (GRCm38)
  • G to T, chromosome 11 at 63,133,239 bp (GRCm38)
  • T to C, chromosome 11 at 65,927,649 bp (GRCm38)
  • T to A, chromosome 11 at 73,928,549 bp (GRCm38)
  • T to A, chromosome 11 at 78,949,158 bp (GRCm38)
  • T to C, chromosome 11 at 80,477,654 bp (GRCm38)
  • A to G, chromosome 11 at 102,153,368 bp (GRCm38)
  • A to T, chromosome 11 at 116,070,318 bp (GRCm38)
  • A to G, chromosome 12 at 52,911,907 bp (GRCm38)
  • A to T, chromosome 12 at 86,758,571 bp (GRCm38)
  • A to G, chromosome 12 at 87,795,737 bp (GRCm38)
  • A to C, chromosome 13 at 17,751,855 bp (GRCm38)
  • C to T, chromosome 13 at 22,883,273 bp (GRCm38)
  • T to C, chromosome 13 at 27,388,496 bp (GRCm38)
  • T to A, chromosome 13 at 38,032,375 bp (GRCm38)
  • A to G, chromosome 13 at 77,049,085 bp (GRCm38)
  • A to G, chromosome 13 at 81,492,963 bp (GRCm38)
  • A to G, chromosome 13 at 100,077,862 bp (GRCm38)
  • T to A, chromosome 14 at 42,438,398 bp (GRCm38)
  • G to T, chromosome 14 at 54,963,597 bp (GRCm38)
  • G to A, chromosome 14 at 122,459,688 bp (GRCm38)
  • C to A, chromosome 15 at 53,885,972 bp (GRCm38)
  • A to C, chromosome 15 at 53,885,973 bp (GRCm38)
  • A to T, chromosome 15 at 77,952,006 bp (GRCm38)
  • CTGTTG to CTG, chromosome 15 at 98,845,176 bp (GRCm38)
  • G to A, chromosome 15 at 102,107,142 bp (GRCm38)
  • T to C, chromosome 16 at 29,611,437 bp (GRCm38)
  • G to A, chromosome 16 at 36,919,605 bp (GRCm38)
  • A to T, chromosome 16 at 90,927,387 bp (GRCm38)
  • A to G, chromosome 17 at 32,798,766 bp (GRCm38)
  • G to A, chromosome 17 at 35,237,757 bp (GRCm38)
  • A to T, chromosome 17 at 36,901,659 bp (GRCm38)
  • G to A, chromosome 17 at 65,582,741 bp (GRCm38)
  • G to T, chromosome 17 at 71,105,480 bp (GRCm38)
  • T to C, chromosome 19 at 5,602,315 bp (GRCm38)
  • A to T, chromosome 19 at 12,394,619 bp (GRCm38)
  • G to T, chromosome 19 at 45,571,983 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9612 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069405-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.