Strain Name:
C57BL/6J-MtgxR9612Btlr/Mmmh
Stock Number:
069405-MU
Citation ID:
RRID:MMRRC_069405-MU
Other Names:
R9612 (G1)
Major Collection:

Strain Information

Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Cdon
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CDO, CAM-related/down-regulated by oncogenes
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Pmp22
Name: peripheral myelin protein 22
Synonyms: Gas-3, TRE002
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Bri3bp
Name: Bri3 binding protein
Synonyms: 2410150I18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76809
Homologene: 50955
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Gpr21
Name: G protein-coupled receptor 21
Synonyms: C230004C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 338346
HGNC: HGNC:4476
Homologene: 74546
Cdk13
Name: cyclin dependent kinase 13
Synonyms: 2310015O17Rik, Cdc2l5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69562
VEGA: 13
HGNC: HGNC:1733
Homologene: 135707
Cstf3
Name: cleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms: 4732468G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228410
HGNC: HGNC:2485
Homologene: 1014
Klhdc4
Name: kelch domain containing 4
Synonyms: G430025P05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234825
Homologene: 69234
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20336
Homologene: 40654
Vapa
Name: vesicle-associated membrane protein, associated protein A
Synonyms: VAP33, synaptobrevin-associated protein of 33kDa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30960
VEGA: 17
Homologene: 37824
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Bet1
Name: Bet1 golgi vesicular membrane trafficking protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12068
Homologene: 38108
Lefty2
Name: left-right determination factor 2
Synonyms: 6030463A22Rik, Ebaf, Leftb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320202
HGNC: HGNC:3122
Homologene: 2434
Fkbp8
Name: FK506 binding protein 8
Synonyms: Fkbp38, 38kDa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14232
HGNC: HGNC:3724
Homologene: 7720
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Stk40
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74178
Homologene: 12542
Zfp958
Name: zinc finger protein 958
Synonyms: BC003267
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 233987
Homologene: 129582
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Zic5
Name: zinc finger protein of the cerebellum 5
Synonyms: odd-paired related, Opr, 1700049L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65100
Homologene: 11301
Tdo2
Name: tryptophan 2,3-dioxygenase
Synonyms: TDO, TO, chky
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56720
Homologene: 4132
Adam15
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11490
HGNC: HGNC:193
Homologene: 2829
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Tns2
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Garre1
Name: granule associated Rac and RHOG effector 1
Synonyms: 4931406P16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233103
Homologene: 8795
Evc2
Name: EvC ciliary complex subunit 2
Synonyms: limbin, Lbn, Ellis van Creveld syndrome 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68525
Homologene: 17117
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75172
Homologene: 67159
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624765
Homologene: 83483
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Glmn
Name: glomulin, FKBP associated protein
Synonyms: 9330160J16Rik, Fap68, Fap48
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170823
Homologene: 14239
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76422
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Zfp811
Name: zinc finger protein 811
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240063
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Lrrc74a
Name: leucine rich repeat containing 74A
Synonyms: Gm6772, Lrrc74
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 627607
VEGA: 12
Homologene: 19331
Herc6
Name: hect domain and RLD 6
Synonyms: 4930427L17Rik, 1700121D12Rik, CEB1, 2510038N07Rik, Herc5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Cdk5r1
Name: cyclin dependent kinase 5, regulatory subunit 1
Synonyms: p35, D11Bwg0379e, p25
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12569
HGNC: HGNC:1775
Homologene: 31200
Or5an6
Name: olfactory receptor family 5 subfamily AN member 6
Synonyms: GA_x6K02T2RE5P-2725206-2726153, MOR215-1, Olfr1440
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258679
Homologene: 128133
Foxred2
Name: FAD-dependent oxidoreductase domain containing 2
Synonyms: LOC239554, A430097D04Rik, D15Bwg0759e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239554
Homologene: 11800
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Grip1
Name: glutamate receptor interacting protein 1
Synonyms: 4931400F03Rik, eb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74053
Homologene: 12938
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Nlrc2, Card15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Plppr4
Name: phospholipid phosphatase related 4
Synonyms: D3Bwg0562e, Lppr4, PRG-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229791
Homologene: 8895
Or5p66
Name: olfactory receptor family 5 subfamily P member 66
Synonyms: GA_x6K02T2PBJ9-10617173-10616229, MOR204-17, Olfr490
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258491
Homologene: 73955
Extl2
Name: exostosin-like glycosyltransferase 2
Synonyms: 3000001D04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58193
HGNC: HGNC:3516
Homologene: 1102
Lrif1
Name: ligand dependent nuclear receptor interacting factor 1
Synonyms: 2010012G17Rik, 4933421E11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 321000
Homologene: 10160
Tmem101
Name: transmembrane protein 101
Synonyms: 2610511E22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76547
Homologene: 12649
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 353371
Homologene: 137359
Prl2b1
Name: prolactin family 2, subfamily b, member 1
Synonyms: PLP-K, 2310047B08Rik, Prlpk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66392
Homologene: 11963
Oas1a
Name: 2'-5' oligoadenylate synthetase 1A
Synonyms: L3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246730
HGNC: HGNC:8086
Homologene: 1903
Smyd2
Name: SET and MYND domain containing 2
Synonyms: Zmynd14, 1110020E07Rik, KMT3C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226830
Homologene: 32466
Vmn1r212
Name: vomeronasal 1 receptor 212
Synonyms: V1rh18
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171275
Homologene: 110880
Ppp1r42
Name: protein phosphatase 1, regulatory subunit 42
Synonyms: 1700011J18Rik, 4930418G15Rik, Lrrc67
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69312
Homologene: 27077
Cfap298
Name: cilia and flagella associate protien 298
Synonyms: 1110004E09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68001
HGNC: HGNC:1301
Homologene: 10941
Or7g21
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
HGNC: HGNC:8466
Homologene: 115507
Or7g29
Name: olfactory receptor family 7 subfamily G member 29
Synonyms: GA_x6K02T2PVTD-13113073-13112135, MOR149-2, Olfr847
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258518
Homologene: 17281
Trim31
Name: tripartite motif-containing 31
Synonyms: HCG1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224762
Homologene: 17137
Ccnl1
Name: cyclin L1
Synonyms: ania-6a, 2610030E23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56706
Homologene: 10541
Oxct2a
Name: 3-oxoacid CoA transferase 2A
Synonyms: Oxct2, Scot-t1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64059
Homologene: 137359
Gm8005
Name: predicted gene 8005
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666253
Homologene: 128452
Atp6v1g2
Name: ATPase, H+ transporting, lysosomal V1 subunit G2
Synonyms: 1500002D01Rik, NG38, VAG2, Atp6g2, lysosomal 13kDa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66237
HGNC: HGNC:862
Homologene: 41518
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: 4921528O07Rik, Armc11
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Gm7489
Name: predicted gene 7489
Type: Gene
Species: Mouse
Chromosome: 15
Igkv14-100
Name: immunoglobulin kappa chain variable 14-100
Synonyms: Gm16635
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243439
Rnaseh2c
Name: ribonuclease H2, subunit C
Synonyms: 1500026D16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68209
Homologene: 32666
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Or1e1d-ps1
Name: olfactory receptor family 1 subfamily E member 1D, pseudogene 1
Synonyms: GA_x6K02T2P1NL-4083149-4084087, MOR135-19, Olfr396-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258208
Gm17018
Name: predicted gene 17018
Type: Gene
Species: Mouse
Chromosome: 19
Eif1ad13
Name: eukaryotic translation initiation factor 1A domain containing 13
Synonyms: Gm21936
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100861898
Homologene: 103865
5730480H06Rik
Name: RIKEN cDNA 5730480H06 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70592
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 9,968,842 bp (GRCm38)
  • T to A, chromosome 1 at 72,665,135 bp (GRCm38)
  • T to A, chromosome 1 at 93,025,694 bp (GRCm38)
  • T to C, chromosome 1 at 136,190,975 bp (GRCm38)
  • A to G, chromosome 1 at 163,038,929 bp (GRCm38)
  • T to A, chromosome 1 at 180,894,721 bp (GRCm38)
  • C to A, chromosome 1 at 188,359,866 bp (GRCm38)
  • T to C, chromosome 1 at 189,880,786 bp (GRCm38)
  • T to C, chromosome 2 at 37,518,387 bp (GRCm38)
  • T to A, chromosome 2 at 66,533,364 bp (GRCm38)
  • G to T, chromosome 2 at 104,653,025 bp (GRCm38)
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp (GRCm38)
  • C to A, chromosome 3 at 65,957,983 bp (GRCm38)
  • C to A, chromosome 3 at 81,971,694 bp (GRCm38)
  • T to C, chromosome 3 at 83,270,886 bp (GRCm38)
  • T to A, chromosome 3 at 89,341,940 bp (GRCm38)
  • A to G, chromosome 3 at 89,609,396 bp (GRCm38)
  • C to T, chromosome 3 at 90,199,866 bp (GRCm38)
  • T to A, chromosome 3 at 97,581,147 bp (GRCm38)
  • T to A, chromosome 3 at 106,731,884 bp (GRCm38)
  • T to A, chromosome 3 at 116,027,496 bp (GRCm38)
  • T to A, chromosome 3 at 117,321,961 bp (GRCm38)
  • A to G, chromosome 3 at 145,545,205 bp (GRCm38)
  • T to C, chromosome 4 at 35,708,450 bp (GRCm38)
  • A to C, chromosome 4 at 123,117,226 bp (GRCm38)
  • T to A, chromosome 4 at 123,323,336 bp (GRCm38)
  • A to G, chromosome 4 at 126,136,857 bp (GRCm38)
  • G to T, chromosome 5 at 21,330,579 bp (GRCm38)
  • G to T, chromosome 5 at 37,386,786 bp (GRCm38)
  • A to G, chromosome 5 at 48,374,530 bp (GRCm38)
  • T to C, chromosome 5 at 107,593,865 bp (GRCm38)
  • T to C, chromosome 5 at 107,795,712 bp (GRCm38)
  • A to T, chromosome 5 at 120,901,965 bp (GRCm38)
  • T to C, chromosome 5 at 125,454,326 bp (GRCm38)
  • A to T, chromosome 6 at 4,077,918 bp (GRCm38)
  • T to C, chromosome 6 at 33,249,226 bp (GRCm38)
  • T to G, chromosome 6 at 57,652,032 bp (GRCm38)
  • T to A, chromosome 6 at 60,976,424 bp (GRCm38)
  • T to A, chromosome 6 at 68,519,333 bp (GRCm38)
  • G to T, chromosome 6 at 137,414,320 bp (GRCm38)
  • G to A, chromosome 7 at 24,628,947 bp (GRCm38)
  • A to T, chromosome 7 at 25,355,063 bp (GRCm38)
  • A to T, chromosome 7 at 34,248,231 bp (GRCm38)
  • T to C, chromosome 7 at 41,626,903 bp (GRCm38)
  • A to G, chromosome 7 at 108,286,280 bp (GRCm38)
  • T to A, chromosome 8 at 4,628,298 bp (GRCm38)
  • A to T, chromosome 8 at 55,872,083 bp (GRCm38)
  • G to A, chromosome 8 at 70,531,674 bp (GRCm38)
  • G to T, chromosome 8 at 88,670,473 bp (GRCm38)
  • A to G, chromosome 8 at 121,801,178 bp (GRCm38)
  • TG to TGG, chromosome 9 at 7,465,083 bp (GRCm38)
  • A to G, chromosome 9 at 7,560,607 bp (GRCm38)
  • T to A, chromosome 9 at 19,121,464 bp (GRCm38)
  • A to G, chromosome 9 at 19,375,381 bp (GRCm38)
  • G to A, chromosome 9 at 35,486,905 bp (GRCm38)
  • A to T, chromosome 9 at 119,127,465 bp (GRCm38)
  • A to T, chromosome 10 at 77,265,929 bp (GRCm38)
  • A to C, chromosome 10 at 79,194,878 bp (GRCm38)
  • T to A, chromosome 10 at 82,289,619 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • T to C, chromosome 11 at 22,169,124 bp (GRCm38)
  • G to T, chromosome 11 at 63,133,239 bp (GRCm38)
  • T to C, chromosome 11 at 65,927,649 bp (GRCm38)
  • T to A, chromosome 11 at 73,928,549 bp (GRCm38)
  • T to A, chromosome 11 at 78,949,158 bp (GRCm38)
  • T to C, chromosome 11 at 80,477,654 bp (GRCm38)
  • A to G, chromosome 11 at 102,153,368 bp (GRCm38)
  • A to T, chromosome 11 at 116,070,318 bp (GRCm38)
  • A to G, chromosome 12 at 52,911,907 bp (GRCm38)
  • A to T, chromosome 12 at 86,758,571 bp (GRCm38)
  • A to G, chromosome 12 at 87,795,737 bp (GRCm38)
  • A to C, chromosome 13 at 17,751,855 bp (GRCm38)
  • C to T, chromosome 13 at 22,883,273 bp (GRCm38)
  • T to C, chromosome 13 at 27,388,496 bp (GRCm38)
  • T to A, chromosome 13 at 38,032,375 bp (GRCm38)
  • A to G, chromosome 13 at 77,049,085 bp (GRCm38)
  • A to G, chromosome 13 at 81,492,963 bp (GRCm38)
  • A to G, chromosome 13 at 100,077,862 bp (GRCm38)
  • T to A, chromosome 14 at 42,438,398 bp (GRCm38)
  • G to T, chromosome 14 at 54,963,597 bp (GRCm38)
  • G to A, chromosome 14 at 122,459,688 bp (GRCm38)
  • C to A, chromosome 15 at 53,885,972 bp (GRCm38)
  • A to C, chromosome 15 at 53,885,973 bp (GRCm38)
  • A to T, chromosome 15 at 77,952,006 bp (GRCm38)
  • CTGTTG to CTG, chromosome 15 at 98,845,176 bp (GRCm38)
  • G to A, chromosome 15 at 102,107,142 bp (GRCm38)
  • T to C, chromosome 16 at 29,611,437 bp (GRCm38)
  • G to A, chromosome 16 at 36,919,605 bp (GRCm38)
  • A to T, chromosome 16 at 90,927,387 bp (GRCm38)
  • A to G, chromosome 17 at 32,798,766 bp (GRCm38)
  • G to A, chromosome 17 at 35,237,757 bp (GRCm38)
  • A to T, chromosome 17 at 36,901,659 bp (GRCm38)
  • G to A, chromosome 17 at 65,582,741 bp (GRCm38)
  • G to T, chromosome 17 at 71,105,480 bp (GRCm38)
  • T to C, chromosome 19 at 5,602,315 bp (GRCm38)
  • A to T, chromosome 19 at 12,394,619 bp (GRCm38)
  • G to T, chromosome 19 at 45,571,983 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9612 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069405-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.