Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9620Btlr/Mmmh
Stock Number:
069413-MU
Citation ID:
RRID:MMRRC_069413-MU
Other Names:
R9620 (G1)
Major Collection:

Strain Information

Luc7l3
Name: LUC7-like 3 (S. cerevisiae)
Synonyms: 3300001P08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67684
Homologene: 75056
Exoc6b
Name: exocyst complex component 6B
Synonyms: 4930569O18Rik, G430127E12Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Vars1
Name: valyl-tRNA synthetase 1
Synonyms: G7a, D17H6S56E, Bat-6, Bat6, Vars2, Vars
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22321
Homologene: 4587
Ripk1
Name: receptor (TNFRSF)-interacting serine-threonine kinase 1
Synonyms: Rinp, Rip1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19766
Homologene: 2820
Aldh16a1
Name: aldehyde dehydrogenase 16 family, member A1
Synonyms: 2410004H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69748
Homologene: 34938
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310067L22Rik, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Mafa
Name: MAF bZIP transcription factor A
Synonyms: RIPE3b1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 378435
VEGA: 15
Homologene: 65867
Unc45a
Name: unc-45 myosin chaperone A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101869
Homologene: 32423
Abhd3
Name: abhydrolase domain containing 3
Synonyms: LABH3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106861
Homologene: 14055
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Prmt2
Name: protein arginine N-methyltransferase 2
Synonyms: Hrmt1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15468
HGNC: HGNC:5186
Homologene: 55587
Ptprm
Name: protein tyrosine phosphatase receptor type M
Synonyms: RPTPmu
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19274
VEGA: 17
HGNC: HGNC:9675
Homologene: 37694
Acsf2
Name: acyl-CoA synthetase family member 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 264895
Homologene: 23519
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Ilkap
Name: integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms: 1600009O09Rik, PP2C-DELTA, 0710007A14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67444
Homologene: 31525
Trap1
Name: TNF receptor-associated protein 1
Synonyms: HSP75, 2410002K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68015
Homologene: 9457
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: 3110031A07Rik, 2410140K03Rik, D5Ertd591e, A630018G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Fbxo34
Name: F-box protein 34
Synonyms: 5830426G16Rik, 2900057B08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78938
VEGA: 14
Homologene: 12713
Slc16a6
Name: solute carrier family 16 (monocarboxylic acid transporters), member 6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104681
Homologene: 20984
Golm2
Name: golgi membrane protein 2
Synonyms: D130060C09Rik, Casc4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319996
Homologene: 16310
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Fgfr4
Name: fibroblast growth factor receptor 4
Synonyms: Fgfr-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14186
HGNC: HGNC:3691
Homologene: 20461
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, cAMP-GEFII, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Pate14
Name: prostate and testis expressed 14
Synonyms: LOC235973, Sslp-1, A630095E13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235973
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Lpcat3
Name: lysophosphatidylcholine acyltransferase 3
Synonyms: Grcc3f, Oact5, Mboat5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14792
Homologene: 14678
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Dcst2
Name: DC-STAMP domain containing 2
Synonyms: LOC329702
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329702
Homologene: 16951
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Micalcl
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Slc27a6
Name: solute carrier family 27 (fatty acid transporter), member 6
Synonyms: FATP6, 4732438L20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225579
Homologene: 38385
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Lipo3
Name: lipase, member O3
Synonyms: Lipo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381236
Homologene: 103863
Snx14
Name: sorting nexin 14
Synonyms: YR-14, C330035N22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244962
Homologene: 17823
Amer3
Name: APC membrane recruitment 3
Synonyms: Fam123c, 9430069J07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211383
Homologene: 51888
Enthd1
Name: ENTH domain containing 1
Synonyms: LOC383075
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 383075
VEGA: 15
Homologene: 45131
Or52i2
Name: olfactory receptor family 52 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-5386601-5387575, MOR41-1, Olfr556
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258749
Homologene: 17380
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Slco2a1
Name: solute carrier organic anion transporter family, member 2a1
Synonyms: Pgt, 2310021C19Rik, mPgt, Slc21a2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24059
Homologene: 38077
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
Mill1
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 266815
Homologene: 105329
Vmn2r69
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330581
Homologene: 115466
Zfp697
Name: zinc finger protein 697
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242109
Homologene: 18241
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13087
Homologene: 85917
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: p493F12, JNK3, Serk2, C230008H04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Or8g50
Name: olfactory receptor family 8 subfamily G member 50
Synonyms: M93, MOR171-18, GA_x6K02T2PVTD-33434302-33435240, Olfr150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258602
VEGA: 9
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Rgmb
Name: repulsive guidance molecule family member B
Synonyms: 1110059F19Rik, DRAGON, RGM domain family, member B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68799
VEGA: 17
Homologene: 65355
Mgat1
Name: mannoside acetylglucosaminyltransferase 1
Synonyms: Mgat-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17308
HGNC: HGNC:7044
Homologene: 1804
H2az2
Name: H2A.Z histone variant 2
Synonyms: C530002L11Rik, H2A.Z2, H2afv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77605
Homologene: 83271
Ttc9b
Name: tetratricopeptide repeat domain 9B
Synonyms: 2900074C18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73032
Homologene: 19938
Rnf5
Name: ring finger protein 5
Synonyms: 2410131O05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54197
Homologene: 56004
Pcdhgb5
Name: protocadherin gamma subfamily B, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93702
HGNC: HGNC:8712
Homologene: 55773
Fam181a
Name: family with sequence similarity 181, member A
Synonyms: EG544888
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504156
Homologene: 34701
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Or10b1
Name: olfactory receptor family 10 subfamily B member 1
Synonyms: GA_x6K02T2QGN0-3289955-3289014, MOR267-9, Olfr1358
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258224
Homologene: 106627
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 34,588,962 bp (GRCm38)
  • T to C, chromosome 1 at 87,153,131 bp (GRCm38)
  • A to G, chromosome 1 at 91,376,251 bp (GRCm38)
  • T to C, chromosome 1 at 136,108,171 bp (GRCm38)
  • A to G, chromosome 1 at 162,833,821 bp (GRCm38)
  • A to C, chromosome 2 at 70,574,276 bp (GRCm38)
  • A to G, chromosome 2 at 72,205,707 bp (GRCm38)
  • T to C, chromosome 2 at 121,906,761 bp (GRCm38)
  • A to G, chromosome 2 at 125,747,474 bp (GRCm38)
  • A to T, chromosome 3 at 89,370,518 bp (GRCm38)
  • A to G, chromosome 3 at 98,427,866 bp (GRCm38)
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp (GRCm38)
  • T to A, chromosome 4 at 121,053,206 bp (GRCm38)
  • A to T, chromosome 5 at 64,954,803 bp (GRCm38)
  • A to C, chromosome 5 at 102,966,607 bp (GRCm38)
  • A to G, chromosome 5 at 143,717,399 bp (GRCm38)
  • T to A, chromosome 6 at 85,011,320 bp (GRCm38)
  • C to T, chromosome 6 at 124,703,580 bp (GRCm38)
  • G to A, chromosome 7 at 18,263,102 bp (GRCm38)
  • G to T, chromosome 7 at 26,551,044 bp (GRCm38)
  • T to A, chromosome 7 at 26,837,211 bp (GRCm38)
  • C to A, chromosome 7 at 27,654,087 bp (GRCm38)
  • T to C, chromosome 7 at 29,015,713 bp (GRCm38)
  • G to A, chromosome 7 at 45,147,989 bp (GRCm38)
  • A to C, chromosome 7 at 80,325,655 bp (GRCm38)
  • T to A, chromosome 7 at 85,412,296 bp (GRCm38)
  • A to T, chromosome 7 at 102,670,804 bp (GRCm38)
  • A to G, chromosome 7 at 103,250,972 bp (GRCm38)
  • A to T, chromosome 7 at 112,381,196 bp (GRCm38)
  • A to T, chromosome 8 at 85,299,801 bp (GRCm38)
  • A to T, chromosome 8 at 94,476,406 bp (GRCm38)
  • G to T, chromosome 9 at 14,548,673 bp (GRCm38)
  • A to G, chromosome 9 at 36,637,202 bp (GRCm38)
  • A to T, chromosome 9 at 39,736,991 bp (GRCm38)
  • A to G, chromosome 9 at 88,381,741 bp (GRCm38)
  • G to C, chromosome 9 at 103,084,866 bp (GRCm38)
  • A to T, chromosome 10 at 76,225,379 bp (GRCm38)
  • G to T, chromosome 10 at 78,520,294 bp (GRCm38)
  • A to T, chromosome 10 at 106,913,658 bp (GRCm38)
  • A to T, chromosome 11 at 6,429,094 bp (GRCm38)
  • T to C, chromosome 11 at 49,261,295 bp (GRCm38)
  • G to A, chromosome 11 at 94,321,719 bp (GRCm38)
  • C to T, chromosome 11 at 94,572,586 bp (GRCm38)
  • A to T, chromosome 11 at 100,188,360 bp (GRCm38)
  • T to C, chromosome 11 at 109,463,496 bp (GRCm38)
  • T to C, chromosome 11 at 116,447,120 bp (GRCm38)
  • A to C, chromosome 12 at 78,715,303 bp (GRCm38)
  • A to G, chromosome 12 at 81,950,186 bp (GRCm38)
  • T to G, chromosome 12 at 103,316,332 bp (GRCm38)
  • T to G, chromosome 13 at 34,026,823 bp (GRCm38)
  • T to A, chromosome 13 at 55,161,181 bp (GRCm38)
  • T to A, chromosome 13 at 67,591,668 bp (GRCm38)
  • A to G, chromosome 14 at 47,531,268 bp (GRCm38)
  • T to A, chromosome 15 at 55,362,385 bp (GRCm38)
  • T to A, chromosome 15 at 75,747,312 bp (GRCm38)
  • G to A, chromosome 15 at 80,452,700 bp (GRCm38)
  • A to T, chromosome 16 at 4,040,219 bp (GRCm38)
  • T to C, chromosome 16 at 36,919,449 bp (GRCm38)
  • G to A, chromosome 17 at 15,821,017 bp (GRCm38)
  • A to G, chromosome 17 at 23,478,476 bp (GRCm38)
  • C to T, chromosome 17 at 34,601,747 bp (GRCm38)
  • A to G, chromosome 17 at 35,016,025 bp (GRCm38)
  • A to G, chromosome 17 at 66,809,489 bp (GRCm38)
  • G to T, chromosome 18 at 10,704,605 bp (GRCm38)
  • C to T, chromosome 18 at 37,731,433 bp (GRCm38)
  • T to A, chromosome 18 at 58,609,815 bp (GRCm38)
  • T to C, chromosome 19 at 4,750,507 bp (GRCm38)
  • A to T, chromosome 19 at 33,582,229 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9620 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069413-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.