Strain Name:
C57BL/6J-MtgxR9622Btlr/Mmmh
Stock Number:
069415-MU
Citation ID:
RRID:MMRRC_069415-MU
Other Names:
R9622 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Mras
Name: muscle and microspikes RAS
Synonyms: 2900078C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17532
HGNC: HGNC:7227
Homologene: 7424
Zmat5
Name: zinc finger, matrin type 5
Synonyms: D11Bwg1548e, D11Bwg0572e, 2610510L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67178
Homologene: 32439
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Nr1f2, Rorbeta, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Acly
Name: ATP citrate lyase
Synonyms: A730098H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104112
HGNC: HGNC:115
Homologene: 854
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Gigyf1
Name: GRB10 interacting GYF protein 1
Synonyms: Perq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57330
HGNC: HGNC:9126
Homologene: 57145
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Tom1l2
Name: target of myb1-like 2 (chicken)
Synonyms: 2900016I08Rik, myb1-like protein 2, A730055F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216810
Homologene: 44901
Tlk1
Name: tousled-like kinase 1
Synonyms: 4930545J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228012
Homologene: 130657
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110058
Homologene: 9553
Ablim2
Name: actin-binding LIM protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231148
Homologene: 82366
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Metap2
Name: methionine aminopeptidase 2
Synonyms: p67, eIF-2-associated p67, A930035J23Rik, 4930584B20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56307
Homologene: 4981
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239102
Homologene: 52657
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 282619
Homologene: 17900
Tmem139
Name: transmembrane protein 139
Synonyms: A930027H06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109218
VEGA: 6
Homologene: 51920
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14255
HGNC: HGNC:3765
Homologene: 3040
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Gp1bb
Name: glycoprotein Ib, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14724
VEGA: 16
HGNC: HGNC:4440
Homologene: 30972
Camk1
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: D6Ertd263e, CaMKIalpha, Camk
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52163
HGNC: HGNC:1459
Homologene: 117458
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Nkpd1
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69547
Homologene: 18876
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545874
Homologene: 135915
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Hoxb3
Name: homeobox B3
Synonyms: Hox-2.7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15410
HGNC: HGNC:5114
Homologene: 1617
Myo5b
Name: myosin VB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Or10a3m
Name: olfactory receptor family 10 subfamily A member 3M
Synonyms: GA_x6K02T2PBJ9-11043421-11044365, MOR268-3, Olfr512
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258719
HGNC: HGNC:8162
Homologene: 138316
Or10p1
Name: olfactory receptor family 10 subfamily P member 1
Synonyms: GA_x6K02T2PULF-11287099-11286167, MOR269-1, Olfr796
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258933
Homologene: 17439
Fcrla
Name: Fc receptor-like A
Synonyms: FCRL1, FREB, Fcrx, Freb1, mFREB, mFcrX
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98752
Homologene: 13106
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Kv2.1, Kcr1-1, Shab
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Sanbr
Name: SANT and BTB domain regulator of CSR
Synonyms: 0610010F05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71675
Homologene: 19038
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Aldh3b2
Name: aldehyde dehydrogenase 3 family, member B2
Synonyms: C130048D07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 621603
HGNC: HGNC:411
Homologene: 84430
Pdzrn4
Name: PDZ domain containing RING finger 4
Synonyms: SAMCAP3L, LNX4, 1110017D07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239618
VEGA: 15
Homologene: 85433
Stt3a
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
Synonyms: Itm1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16430
HGNC: HGNC:6172
Homologene: 40617
Psmb4
Name: proteasome (prosome, macropain) subunit, beta type 4
Synonyms: Pros-27
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19172
HGNC: HGNC:9541
Homologene: 2090
Dnaaf1
Name: dynein, axonemal assembly factor 1
Synonyms: 4930457P18Rik, Lrrc50, m4Bei
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68270
Homologene: 12256
Xkr5
Name: X-linked Kx blood group related 5
Synonyms: 5430438H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319581
Homologene: 52219
Elmo1
Name: engulfment and cell motility 1
Synonyms: CED-12, C230095H21Rik, 6330578D22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 140580
Homologene: 56685
H2-Q1
Name: histocompatibility 2, Q region locus 1
Synonyms: H-2Q1, Q1k, Q1d, Q1b, Q1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15006
Homologene: 128352
Lcn4
Name: lipocalin 4
Synonyms: Vnsp2, A630045M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16821
Homologene: 86960
Cyp4f16
Name: cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms: 2310021J05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70101
Homologene: 135840
Or1j1
Name: olfactory receptor family 1 subfamily J member 1
Synonyms: Y71, MOR136-14, GA_x6K02T2NLDC-33507606-33506665, Olfr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18328
HGNC: HGNC:8208
Homologene: 66579
Teddm1b
Name: transmembrane epididymal protein 1B
Synonyms: Gm5531
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 433365
Homologene: 131186
Rcc1l
Name: reculator of chromosome condensation 1 like
Synonyms: 5730496C04Rik, Wbscr16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94254
Homologene: 36477
Zfp3
Name: zinc finger protein 3
Synonyms: Fnp-1, Zfp-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193043
Homologene: 27406
Plekhb1
Name: pleckstrin homology domain containing, family B (evectins) member 1
Synonyms: PHR1, Phret1, evt-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27276
Homologene: 8449
Mas1
Name: MAS1 oncogene
Synonyms: Mas-1, Mas receptor, MasR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17171
HGNC: HGNC:6899
Homologene: 1782
Tas2r134
Name: taste receptor, type 2, member 134
Synonyms: Tas2r34, T2R134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 387511
Homologene: 66001
Cfap418
Name: cilia and flagella associated protein 418
Synonyms: 2610301B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67157
Homologene: 18641
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Cyp4a30b
Name: cytochrome P450, family 4, subfamily a, polypeptide 30b
Synonyms: OTTMUSG00000008626, Cyp4a30b-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435802
Zc2hc1b
Name: zinc finger, C2HC-type containing 1B
Synonyms: 4930519B02Rik, Fam164b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75122
VEGA: 10
Homologene: 77965
Asphd1
Name: aspartate beta-hydroxylase domain containing 1
Synonyms: A830007L07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233879
Or51i2
Name: olfactory receptor family 51 subfamily I member 2
Synonyms: GA_x6K02T2PBJ9-6773690-6774628, MOR13-3, Olfr641
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259075
Homologene: 17489
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 107,524,568 bp (GRCm38)
  • C to A, chromosome 1 at 151,428,959 bp (GRCm38)
  • T to A, chromosome 1 at 153,874,874 bp (GRCm38)
  • T to A, chromosome 1 at 170,922,239 bp (GRCm38)
  • G to A, chromosome 2 at 26,671,216 bp (GRCm38)
  • A to G, chromosome 2 at 36,812,609 bp (GRCm38)
  • G to A, chromosome 2 at 40,889,342 bp (GRCm38)
  • A to C, chromosome 2 at 51,628,346 bp (GRCm38)
  • T to A, chromosome 2 at 70,786,937 bp (GRCm38)
  • T to C, chromosome 2 at 167,188,241 bp (GRCm38)
  • T to C, chromosome 3 at 49,756,780 bp (GRCm38)
  • G to C, chromosome 3 at 58,636,741 bp (GRCm38)
  • C to T, chromosome 3 at 83,356,459 bp (GRCm38)
  • C to A, chromosome 3 at 94,884,974 bp (GRCm38)
  • T to C, chromosome 3 at 100,952,602 bp (GRCm38)
  • T to C, chromosome 4 at 10,893,304 bp (GRCm38)
  • T to G, chromosome 4 at 43,172,513 bp (GRCm38)
  • T to C, chromosome 4 at 46,609,065 bp (GRCm38)
  • C to T, chromosome 4 at 46,724,283 bp (GRCm38)
  • A to G, chromosome 4 at 115,470,965 bp (GRCm38)
  • A to G, chromosome 4 at 143,965,778 bp (GRCm38)
  • T to C, chromosome 4 at 148,483,712 bp (GRCm38)
  • A to G, chromosome 5 at 35,849,545 bp (GRCm38)
  • C to A, chromosome 5 at 104,087,132 bp (GRCm38)
  • A to G, chromosome 5 at 134,176,509 bp (GRCm38)
  • T to A, chromosome 5 at 137,524,664 bp (GRCm38)
  • C to T, chromosome 5 at 147,367,031 bp (GRCm38)
  • T to C, chromosome 5 at 150,556,945 bp (GRCm38)
  • A to T, chromosome 6 at 42,263,242 bp (GRCm38)
  • T to A, chromosome 6 at 113,341,889 bp (GRCm38)
  • T to C, chromosome 6 at 114,678,032 bp (GRCm38)
  • T to C, chromosome 6 at 122,051,792 bp (GRCm38)
  • T to A, chromosome 6 at 123,839,620 bp (GRCm38)
  • C to A, chromosome 7 at 19,523,942 bp (GRCm38)
  • GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG to GG, chromosome 7 at 30,752,642 bp (GRCm38)
  • A to T, chromosome 7 at 55,879,105 bp (GRCm38)
  • T to C, chromosome 7 at 100,655,381 bp (GRCm38)
  • T to A, chromosome 7 at 104,040,315 bp (GRCm38)
  • T to C, chromosome 7 at 105,704,135 bp (GRCm38)
  • T to A, chromosome 7 at 108,713,470 bp (GRCm38)
  • C to A, chromosome 7 at 118,436,968 bp (GRCm38)
  • A to G, chromosome 7 at 119,962,133 bp (GRCm38)
  • G to A, chromosome 7 at 126,948,802 bp (GRCm38)
  • A to G, chromosome 8 at 18,934,231 bp (GRCm38)
  • C to T, chromosome 8 at 111,172,501 bp (GRCm38)
  • A to G, chromosome 8 at 119,588,262 bp (GRCm38)
  • A to G, chromosome 9 at 36,749,729 bp (GRCm38)
  • T to G, chromosome 9 at 67,949,433 bp (GRCm38)
  • A to T, chromosome 9 at 99,393,001 bp (GRCm38)
  • A to T, chromosome 9 at 119,608,980 bp (GRCm38)
  • G to A, chromosome 10 at 13,167,933 bp (GRCm38)
  • T to C, chromosome 10 at 93,871,504 bp (GRCm38)
  • T to C, chromosome 10 at 109,767,242 bp (GRCm38)
  • G to A, chromosome 10 at 129,608,215 bp (GRCm38)
  • T to C, chromosome 11 at 3,215,714 bp (GRCm38)
  • T to C, chromosome 11 at 4,737,453 bp (GRCm38)
  • T to A, chromosome 11 at 23,584,590 bp (GRCm38)
  • T to C, chromosome 11 at 60,261,116 bp (GRCm38)
  • T to G, chromosome 11 at 70,771,913 bp (GRCm38)
  • A to T, chromosome 11 at 96,344,594 bp (GRCm38)
  • T to C, chromosome 11 at 100,504,959 bp (GRCm38)
  • C to G, chromosome 13 at 20,208,140 bp (GRCm38)
  • A to C, chromosome 14 at 55,066,026 bp (GRCm38)
  • A to T, chromosome 15 at 8,336,889 bp (GRCm38)
  • T to C, chromosome 15 at 71,525,837 bp (GRCm38)
  • T to C, chromosome 15 at 92,397,068 bp (GRCm38)
  • T to C, chromosome 16 at 18,620,777 bp (GRCm38)
  • T to C, chromosome 16 at 29,420,459 bp (GRCm38)
  • A to G, chromosome 16 at 50,274,659 bp (GRCm38)
  • T to C, chromosome 16 at 73,933,064 bp (GRCm38)
  • T to A, chromosome 17 at 3,197,895 bp (GRCm38)
  • T to C, chromosome 17 at 12,842,011 bp (GRCm38)
  • C to T, chromosome 17 at 32,550,272 bp (GRCm38)
  • A to T, chromosome 17 at 35,323,556 bp (GRCm38)
  • A to T, chromosome 17 at 45,404,783 bp (GRCm38)
  • T to A, chromosome 17 at 80,651,109 bp (GRCm38)
  • G to A, chromosome 18 at 6,225,672 bp (GRCm38)
  • A to G, chromosome 18 at 74,714,946 bp (GRCm38)
  • T to A, chromosome 19 at 3,979,489 bp (GRCm38)
  • T to C, chromosome 19 at 18,977,751 bp (GRCm38)
  • A to G, chromosome 19 at 25,121,181 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9622 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069415-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.