Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9622Btlr/Mmmh
Stock Number:
069415-MU
Citation ID:
RRID:MMRRC_069415-MU
Other Names:
R9622 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Sparcl1
Name: SPARC-like 1
Synonyms: Sc1, hevin, mast9, Ecm2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13602
Homologene: 3438
Mras
Name: muscle and microspikes RAS
Synonyms: 2900078C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17532
HGNC: HGNC:7227
Homologene: 7424
Zmat5
Name: zinc finger, matrin type 5
Synonyms: D11Bwg1548e, D11Bwg0572e, 2610510L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67178
Homologene: 32439
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Nr1f2, Rorbeta, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 107,524,568 bp (GRCm38)
  • C to A, chromosome 1 at 151,428,959 bp (GRCm38)
  • T to A, chromosome 1 at 153,874,874 bp (GRCm38)
  • T to A, chromosome 1 at 170,922,239 bp (GRCm38)
  • G to A, chromosome 2 at 26,671,216 bp (GRCm38)
  • A to G, chromosome 2 at 36,812,609 bp (GRCm38)
  • G to A, chromosome 2 at 40,889,342 bp (GRCm38)
  • A to C, chromosome 2 at 51,628,346 bp (GRCm38)
  • T to A, chromosome 2 at 70,786,937 bp (GRCm38)
  • T to C, chromosome 2 at 167,188,241 bp (GRCm38)
  • T to C, chromosome 3 at 49,756,780 bp (GRCm38)
  • G to C, chromosome 3 at 58,636,741 bp (GRCm38)
  • C to T, chromosome 3 at 83,356,459 bp (GRCm38)
  • C to A, chromosome 3 at 94,884,974 bp (GRCm38)
  • T to C, chromosome 3 at 100,952,602 bp (GRCm38)
  • T to C, chromosome 4 at 10,893,304 bp (GRCm38)
  • T to G, chromosome 4 at 43,172,513 bp (GRCm38)
  • T to C, chromosome 4 at 46,609,065 bp (GRCm38)
  • C to T, chromosome 4 at 46,724,283 bp (GRCm38)
  • A to G, chromosome 4 at 115,470,965 bp (GRCm38)
  • A to G, chromosome 4 at 143,965,778 bp (GRCm38)
  • T to C, chromosome 4 at 148,483,712 bp (GRCm38)
  • A to G, chromosome 5 at 35,849,545 bp (GRCm38)
  • C to A, chromosome 5 at 104,087,132 bp (GRCm38)
  • A to G, chromosome 5 at 134,176,509 bp (GRCm38)
  • T to A, chromosome 5 at 137,524,664 bp (GRCm38)
  • C to T, chromosome 5 at 147,367,031 bp (GRCm38)
  • T to C, chromosome 5 at 150,556,945 bp (GRCm38)
  • A to T, chromosome 6 at 42,263,242 bp (GRCm38)
  • T to A, chromosome 6 at 113,341,889 bp (GRCm38)
  • T to C, chromosome 6 at 114,678,032 bp (GRCm38)
  • T to C, chromosome 6 at 122,051,792 bp (GRCm38)
  • T to A, chromosome 6 at 123,839,620 bp (GRCm38)
  • C to A, chromosome 7 at 19,523,942 bp (GRCm38)
  • GGAAATATGGCAGACAAGTTTGGTCAGGGGGCCCACCATGCTTTTGGTCAGGGCAG to GG, chromosome 7 at 30,752,642 bp (GRCm38)
  • A to T, chromosome 7 at 55,879,105 bp (GRCm38)
  • T to C, chromosome 7 at 100,655,381 bp (GRCm38)
  • T to A, chromosome 7 at 104,040,315 bp (GRCm38)
  • T to C, chromosome 7 at 105,704,135 bp (GRCm38)
  • T to A, chromosome 7 at 108,713,470 bp (GRCm38)
  • C to A, chromosome 7 at 118,436,968 bp (GRCm38)
  • A to G, chromosome 7 at 119,962,133 bp (GRCm38)
  • G to A, chromosome 7 at 126,948,802 bp (GRCm38)
  • A to G, chromosome 8 at 18,934,231 bp (GRCm38)
  • C to T, chromosome 8 at 111,172,501 bp (GRCm38)
  • A to G, chromosome 8 at 119,588,262 bp (GRCm38)
  • A to G, chromosome 9 at 36,749,729 bp (GRCm38)
  • T to G, chromosome 9 at 67,949,433 bp (GRCm38)
  • A to T, chromosome 9 at 99,393,001 bp (GRCm38)
  • A to T, chromosome 9 at 119,608,980 bp (GRCm38)
  • G to A, chromosome 10 at 13,167,933 bp (GRCm38)
  • T to C, chromosome 10 at 93,871,504 bp (GRCm38)
  • T to C, chromosome 10 at 109,767,242 bp (GRCm38)
  • G to A, chromosome 10 at 129,608,215 bp (GRCm38)
  • T to C, chromosome 11 at 3,215,714 bp (GRCm38)
  • T to C, chromosome 11 at 4,737,453 bp (GRCm38)
  • T to A, chromosome 11 at 23,584,590 bp (GRCm38)
  • T to C, chromosome 11 at 60,261,116 bp (GRCm38)
  • T to G, chromosome 11 at 70,771,913 bp (GRCm38)
  • A to T, chromosome 11 at 96,344,594 bp (GRCm38)
  • T to C, chromosome 11 at 100,504,959 bp (GRCm38)
  • C to G, chromosome 13 at 20,208,140 bp (GRCm38)
  • A to C, chromosome 14 at 55,066,026 bp (GRCm38)
  • A to T, chromosome 15 at 8,336,889 bp (GRCm38)
  • T to C, chromosome 15 at 71,525,837 bp (GRCm38)
  • T to C, chromosome 15 at 92,397,068 bp (GRCm38)
  • T to C, chromosome 16 at 18,620,777 bp (GRCm38)
  • T to C, chromosome 16 at 29,420,459 bp (GRCm38)
  • A to G, chromosome 16 at 50,274,659 bp (GRCm38)
  • T to C, chromosome 16 at 73,933,064 bp (GRCm38)
  • T to A, chromosome 17 at 3,197,895 bp (GRCm38)
  • T to C, chromosome 17 at 12,842,011 bp (GRCm38)
  • C to T, chromosome 17 at 32,550,272 bp (GRCm38)
  • A to T, chromosome 17 at 35,323,556 bp (GRCm38)
  • A to T, chromosome 17 at 45,404,783 bp (GRCm38)
  • T to A, chromosome 17 at 80,651,109 bp (GRCm38)
  • G to A, chromosome 18 at 6,225,672 bp (GRCm38)
  • A to G, chromosome 18 at 74,714,946 bp (GRCm38)
  • T to A, chromosome 19 at 3,979,489 bp (GRCm38)
  • T to C, chromosome 19 at 18,977,751 bp (GRCm38)
  • A to G, chromosome 19 at 25,121,181 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9622 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069415-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.