Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9628Btlr/Mmmh
Stock Number:
069421-MU
Citation ID:
RRID:MMRRC_069421-MU
Other Names:
R9628 (G1)
Major Collection:

Strain Information

Ntsr1
Name: neurotensin receptor 1
Synonyms: NT-1R, Ntsr1, NTR-1, NTR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18216
HGNC: HGNC:8039
Homologene: 68261
Ess2
Name: ess-2 splicing factor
Synonyms: ES2, Dgsi, D16H22S1269E, Es2el, Dgcr14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27886
VEGA: 16
Homologene: 11184
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Spag7
Name: sperm associated antigen 7
Synonyms: FSA-1, Fsa1l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216873
Homologene: 3595
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Ccz1
Name: CCZ1 vacuolar protein trafficking and biogenesis associated
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231874
Homologene: 56717
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 156,017,574 bp (GRCm38)
  • A to G, chromosome 2 at 60,327,941 bp (GRCm38)
  • A to G, chromosome 2 at 61,653,532 bp (GRCm38)
  • G to A, chromosome 2 at 77,014,494 bp (GRCm38)
  • A to G, chromosome 2 at 89,013,326 bp (GRCm38)
  • T to C, chromosome 2 at 178,441,420 bp (GRCm38)
  • G to A, chromosome 2 at 180,541,481 bp (GRCm38)
  • T to C, chromosome 3 at 40,961,668 bp (GRCm38)
  • T to C, chromosome 3 at 103,055,509 bp (GRCm38)
  • T to C, chromosome 3 at 133,132,264 bp (GRCm38)
  • G to C, chromosome 3 at 157,947,676 bp (GRCm38)
  • A to T, chromosome 4 at 55,009,423 bp (GRCm38)
  • T to C, chromosome 4 at 96,013,323 bp (GRCm38)
  • G to A, chromosome 4 at 140,737,315 bp (GRCm38)
  • T to C, chromosome 4 at 152,484,509 bp (GRCm38)
  • T to G, chromosome 4 at 155,649,697 bp (GRCm38)
  • T to C, chromosome 5 at 31,040,402 bp (GRCm38)
  • C to A, chromosome 5 at 31,300,590 bp (GRCm38)
  • A to G, chromosome 5 at 76,857,076 bp (GRCm38)
  • G to A, chromosome 5 at 143,988,225 bp (GRCm38)
  • G to A, chromosome 5 at 144,553,451 bp (GRCm38)
  • T to A, chromosome 6 at 56,736,475 bp (GRCm38)
  • T to C, chromosome 6 at 85,512,310 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • G to A, chromosome 6 at 115,947,739 bp (GRCm38)
  • T to G, chromosome 6 at 125,081,985 bp (GRCm38)
  • T to C, chromosome 6 at 142,494,136 bp (GRCm38)
  • G to A, chromosome 7 at 4,633,113 bp (GRCm38)
  • A to G, chromosome 7 at 7,812,703 bp (GRCm38)
  • T to A, chromosome 7 at 100,448,754 bp (GRCm38)
  • G to A, chromosome 7 at 112,106,792 bp (GRCm38)
  • T to G, chromosome 9 at 21,955,876 bp (GRCm38)
  • T to G, chromosome 9 at 38,488,575 bp (GRCm38)
  • C to T, chromosome 9 at 92,472,932 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • C to A, chromosome 9 at 108,826,360 bp (GRCm38)
  • T to C, chromosome 10 at 64,087,997 bp (GRCm38)
  • T to C, chromosome 10 at 69,270,823 bp (GRCm38)
  • A to G, chromosome 10 at 76,307,159 bp (GRCm38)
  • T to C, chromosome 10 at 80,283,165 bp (GRCm38)
  • T to C, chromosome 10 at 121,096,644 bp (GRCm38)
  • G to A, chromosome 11 at 4,427,372 bp (GRCm38)
  • T to C, chromosome 11 at 69,322,956 bp (GRCm38)
  • A to T, chromosome 11 at 70,664,360 bp (GRCm38)
  • G to A, chromosome 11 at 73,603,038 bp (GRCm38)
  • C to A, chromosome 11 at 80,557,470 bp (GRCm38)
  • A to G, chromosome 11 at 103,503,504 bp (GRCm38)
  • A to G, chromosome 13 at 23,905,529 bp (GRCm38)
  • A to G, chromosome 13 at 100,824,914 bp (GRCm38)
  • T to C, chromosome 14 at 57,605,173 bp (GRCm38)
  • C to A, chromosome 14 at 62,292,695 bp (GRCm38)
  • A to G, chromosome 14 at 62,587,561 bp (GRCm38)
  • T to C, chromosome 14 at 63,241,096 bp (GRCm38)
  • A to T, chromosome 15 at 96,419,517 bp (GRCm38)
  • A to T, chromosome 16 at 17,902,893 bp (GRCm38)
  • T to C, chromosome 16 at 48,291,309 bp (GRCm38)
  • T to C, chromosome 16 at 56,732,830 bp (GRCm38)
  • G to A, chromosome 18 at 6,788,647 bp (GRCm38)
  • T to A, chromosome 18 at 20,264,316 bp (GRCm38)
  • T to A, chromosome 19 at 43,870,207 bp (GRCm38)
  • GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT to GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT, chromosome X at 37,878,114 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9628 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069421-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.