Strain Name:
C57BL/6J-MtgxR9629Btlr/Mmmh
Stock Number:
069422-MU
Citation ID:
RRID:MMRRC_069422-MU
Other Names:
R9629 (G1)
Major Collection:

Strain Information

Ntsr1
Name: neurotensin receptor 1
Synonyms: NT-1R, Ntsr1, NTR-1, NTR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18216
HGNC: HGNC:8039
Homologene: 68261
Tfap2b
Name: transcription factor AP-2 beta
Synonyms: AP-2(beta), E130018K07Rik, Tcfap2b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21419
Homologene: 20688
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Anks3
Name: ankyrin repeat and sterile alpha motif domain containing 3
Synonyms: 2700067D09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72615
VEGA: 16
Homologene: 12475
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Dis3l2
Name: DIS3 like 3'-5' exoribonuclease 2
Synonyms: 8030493P09Rik, 4930429A22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208718
Homologene: 62417
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Rbbp4
Name: retinoblastoma binding protein 4, chromatin remodeling factor
Synonyms: CAF-1 p48 subunit, RBAP48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19646
HGNC: HGNC:9887
Homologene: 21153
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Piwil1
Name: piwi-like RNA-mediated gene silencing 1
Synonyms: MIWI
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57749
HGNC: HGNC:9007
Homologene: 37963
Tmem123
Name: transmembrane protein 123
Synonyms: 2310075C12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71929
Homologene: 14177
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Ankrd13c
Name: ankyrin repeat domain 13c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433667
Homologene: 41804
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110058
Homologene: 9553
Hpgd
Name: hydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms: 15-PGDH
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15446
HGNC: HGNC:5154
Homologene: 68095
Tmem198b
Name: transmembrane protein 198b
Synonyms: 1110012D08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73827
Homologene: 77634
Flrt3
Name: fibronectin leucine rich transmembrane protein 3
Synonyms: 5530600M07Rik, C430047I10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71436
HGNC: HGNC:3762
Homologene: 8322
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Qtrt2
Name: queuine tRNA-ribosyltransferase accessory subunit 2
Synonyms: 3110012M05Rik, 4930470H18Rik, Qtrtd1, Qrtr2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106248
Homologene: 41576
Dbr1
Name: debranching RNA lariats 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83703
Homologene: 9428
Tmprss2
Name: transmembrane protease, serine 2
Synonyms: epitheliasin, D16Ertd61e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50528
VEGA: 16
Homologene: 4136
Mrgprd
Name: MAS-related GPR, member D
Synonyms: MrgD, LOC211578
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211578
Homologene: 18893
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Ttc8
Name: tetratricopeptide repeat domain 8
Synonyms: 0610012F22Rik, BBS8
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76260
Homologene: 14988
Ttll7
Name: tubulin tyrosine ligase-like family, member 7
Synonyms: 1110049N09Rik, 4921517B04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70892
Homologene: 41578
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Slc13a5
Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
Synonyms: Nact, NaC2/NaCT, mINDY, Indy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237831
Homologene: 21941
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Man1a
Name: mannosidase 1, alpha
Synonyms: PCR1, mannosyl-oligosaccharide alpha-1,2-mannosidase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4, Olfr714
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259035
Homologene: 72055
Cog2
Name: component of oligomeric golgi complex 2
Synonyms: 1190002B08Rik, 2700012E02Rik, Cog2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76332
HGNC: HGNC:6546
Homologene: 7206
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Ppp1r3c
Name: protein phosphatase 1, regulatory subunit 3C
Synonyms: protein targeting to glicogen, PTG, Ppp1r5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53412
VEGA: 19
HGNC: HGNC:9293
Homologene: 3938
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546903
Homologene: 110800
Vmn1r185
Name: vomeronasal 1 receptor 185
Synonyms: V1re12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171265
Homologene: 74353
Slc28a3
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 3
Synonyms: Cnt3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 114304
Homologene: 32533
Hdac9
Name: histone deacetylase 9
Synonyms: HDRP, Hdac7b, Mitr, D030072B18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79221
Homologene: 128578
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433070
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Galnt15
Name: polypeptide N-acetylgalactosaminyltransferase 15
Synonyms: 4631401E18Rik, Galntl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78754
Homologene: 14286
Dhcr7
Name: 7-dehydrocholesterol reductase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13360
HGNC: HGNC:2860
Homologene: 1042
Krt83
Name: keratin 83
Synonyms: 5430421N21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100126226
Homologene: 68248
Tas2r117
Name: taste receptor, type 2, member 117
Synonyms: Tas2r17, mGR17, T2R17, mt2r54
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353166
Homologene: 130073
Itgb5
Name: integrin beta 5
Synonyms: [b]5B, [b]5A, [b]-5, beta-5, beta5, [b]5, ESTM23
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16419
HGNC: HGNC:6160
Homologene: 20511
Epx
Name: eosinophil peroxidase
Synonyms: EPO
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13861
HGNC: HGNC:3423
Homologene: 20144
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330671
Homologene: 27982
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Mrpl54
Name: mitochondrial ribosomal protein L54
Synonyms: 0610008M19Rik, D10Sut1e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66047
Homologene: 11910
Or8g36
Name: olfactory receptor family 8 subfamily G member 36
Synonyms: GA_x6K02T2PVTD-33208209-33207274, MOR171-12, Olfr957
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258740
VEGA: 9
Or4k40
Name: olfactory receptor family 4 subfamily K member 40
Synonyms: GA_x6K02T2Q125-72472405-72471488, MOR248-21, Olfr1286
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277562
Homologene: 73992
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71027
Homologene: 78138
Phospho2
Name: phosphatase, orphan 2
Synonyms: 1700048E23Rik, Phos2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73373
Homologene: 41756
Zfp971
Name: zinc finger protein 971
Synonyms: Etohi1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 626848
Homologene: 134324
Jakmip3
Name: janus kinase and microtubule interacting protein 3
Synonyms: 6330417G02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74004
Homologene: 90425
Nagpa
Name: N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Synonyms: alpha-GlcNAcase, UCE
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27426
Homologene: 8466
Dok6
Name: docking protein 6
Synonyms: Dok-6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 623279
Homologene: 45143
Fcrlb
Name: Fc receptor-like B
Synonyms: FREB-2, FREB2, FcRL2, Fcry, mFCRL2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435653
Homologene: 83202
Gm5150
Name: predicted gene 5150
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381484
Homologene: 129516
Myl1
Name: myosin, light polypeptide 1
Synonyms: MLC3f, MLC1f, Mylf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17901
HGNC: HGNC:7582
Homologene: 23194
Nr2f6
Name: nuclear receptor subfamily 2, group F, member 6
Synonyms: Erbal2, COUP-TF3, EAR2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13864
HGNC: HGNC:7977
Homologene: 7706
Gfy
Name: golgi-associated olfactory signaling regulator
Synonyms: Gm581, Goofy
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100039953
Homologene: 85248
Gltp
Name: glycolipid transfer protein
Synonyms: 1110001F24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56356
Homologene: 41133
Trex1
Name: three prime repair exonuclease 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22040
Homologene: 7982
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Cox7a1
Name: cytochrome c oxidase subunit 7A1
Synonyms: COX7AM, COX7AH, COX7A, COX7AH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12865
HGNC: HGNC:2287
Homologene: 48051
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 19,219,244 bp (GRCm38)
  • A to G, chromosome 1 at 20,392,213 bp (GRCm38)
  • T to A, chromosome 1 at 66,930,289 bp (GRCm38)
  • A to T, chromosome 1 at 80,503,672 bp (GRCm38)
  • T to A, chromosome 1 at 87,047,062 bp (GRCm38)
  • A to G, chromosome 1 at 162,692,390 bp (GRCm38)
  • G to C, chromosome 1 at 170,912,166 bp (GRCm38)
  • GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT to GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT, chromosome 1 at 173,728,995 bp (GRCm38)
  • A to G, chromosome 1 at 176,756,255 bp (GRCm38)
  • T to A, chromosome 2 at 69,795,951 bp (GRCm38)
  • T to A, chromosome 2 at 111,420,792 bp (GRCm38)
  • T to C, chromosome 2 at 140,660,896 bp (GRCm38)
  • A to T, chromosome 2 at 178,033,624 bp (GRCm38)
  • G to A, chromosome 2 at 180,541,481 bp (GRCm38)
  • A to G, chromosome 3 at 15,990,665 bp (GRCm38)
  • C to A, chromosome 3 at 87,095,718 bp (GRCm38)
  • C to T, chromosome 3 at 108,401,599 bp (GRCm38)
  • T to C, chromosome 3 at 146,915,732 bp (GRCm38)
  • G to C, chromosome 3 at 157,947,676 bp (GRCm38)
  • T to C, chromosome 4 at 129,318,450 bp (GRCm38)
  • G to A, chromosome 4 at 156,172,637 bp (GRCm38)
  • C to T, chromosome 5 at 114,676,321 bp (GRCm38)
  • T to C, chromosome 5 at 128,753,987 bp (GRCm38)
  • T to G, chromosome 6 at 66,804,594 bp (GRCm38)
  • T to C, chromosome 6 at 132,803,411 bp (GRCm38)
  • A to G, chromosome 7 at 25,343,769 bp (GRCm38)
  • G to T, chromosome 7 at 26,612,014 bp (GRCm38)
  • A to G, chromosome 7 at 30,185,158 bp (GRCm38)
  • G to A, chromosome 7 at 45,178,361 bp (GRCm38)
  • G to T, chromosome 7 at 98,063,730 bp (GRCm38)
  • C to T, chromosome 7 at 100,380,042 bp (GRCm38)
  • A to T, chromosome 7 at 107,073,957 bp (GRCm38)
  • A to G, chromosome 7 at 118,408,156 bp (GRCm38)
  • G to A, chromosome 7 at 139,023,389 bp (GRCm38)
  • A to G, chromosome 7 at 141,068,662 bp (GRCm38)
  • C to A, chromosome 7 at 143,847,475 bp (GRCm38)
  • A to G, chromosome 7 at 145,321,452 bp (GRCm38)
  • C to A, chromosome 8 at 56,298,384 bp (GRCm38)
  • G to A, chromosome 8 at 71,374,527 bp (GRCm38)
  • G to A, chromosome 8 at 94,306,639 bp (GRCm38)
  • A to G, chromosome 8 at 95,729,246 bp (GRCm38)
  • A to G, chromosome 8 at 112,841,717 bp (GRCm38)
  • T to A, chromosome 8 at 124,533,386 bp (GRCm38)
  • T to C, chromosome 8 at 127,409,672 bp (GRCm38)
  • T to C, chromosome 9 at 7,790,983 bp (GRCm38)
  • T to C, chromosome 9 at 39,511,201 bp (GRCm38)
  • T to A, chromosome 9 at 95,865,045 bp (GRCm38)
  • T to A, chromosome 9 at 99,582,470 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • A to T, chromosome 9 at 109,058,564 bp (GRCm38)
  • C to T, chromosome 9 at 120,017,313 bp (GRCm38)
  • A to T, chromosome 10 at 53,920,062 bp (GRCm38)
  • A to G, chromosome 10 at 80,027,860 bp (GRCm38)
  • C to T, chromosome 10 at 81,265,694 bp (GRCm38)
  • T to A, chromosome 10 at 121,869,841 bp (GRCm38)
  • A to G, chromosome 10 at 128,042,357 bp (GRCm38)
  • T to C, chromosome 10 at 128,361,016 bp (GRCm38)
  • C to A, chromosome 10 at 128,802,517 bp (GRCm38)
  • G to A, chromosome 11 at 8,451,142 bp (GRCm38)
  • A to T, chromosome 11 at 23,364,364 bp (GRCm38)
  • A to G, chromosome 11 at 72,247,752 bp (GRCm38)
  • C to T, chromosome 11 at 87,864,825 bp (GRCm38)
  • T to C, chromosome 11 at 118,088,978 bp (GRCm38)
  • A to T, chromosome 12 at 8,009,054 bp (GRCm38)
  • T to C, chromosome 12 at 34,389,390 bp (GRCm38)
  • T to G, chromosome 12 at 84,997,262 bp (GRCm38)
  • A to G, chromosome 12 at 98,920,706 bp (GRCm38)
  • A to T, chromosome 13 at 58,569,373 bp (GRCm38)
  • G to A, chromosome 14 at 6,218,250 bp (GRCm38)
  • T to A, chromosome 14 at 32,052,344 bp (GRCm38)
  • T to C, chromosome 14 at 35,810,177 bp (GRCm38)
  • A to G, chromosome 15 at 55,519,149 bp (GRCm38)
  • A to T, chromosome 15 at 66,683,738 bp (GRCm38)
  • G to C, chromosome 15 at 101,491,167 bp (GRCm38)
  • C to T, chromosome 16 at 4,957,701 bp (GRCm38)
  • C to G, chromosome 16 at 5,199,965 bp (GRCm38)
  • C to T, chromosome 16 at 33,875,925 bp (GRCm38)
  • T to C, chromosome 16 at 43,863,177 bp (GRCm38)
  • T to G, chromosome 16 at 57,276,222 bp (GRCm38)
  • A to T, chromosome 16 at 97,568,502 bp (GRCm38)
  • A to G, chromosome 17 at 18,582,995 bp (GRCm38)
  • A to T, chromosome 17 at 27,793,939 bp (GRCm38)
  • A to T, chromosome 18 at 15,063,554 bp (GRCm38)
  • G to T, chromosome 18 at 89,473,864 bp (GRCm38)
  • A to G, chromosome 19 at 36,734,004 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9629 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069422-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.