Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9631Btlr/Mmmh
Stock Number:
069424-MU
Citation ID:
RRID:MMRRC_069424-MU
Other Names:
R9631 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Atl3
Name: atlastin GTPase 3
Synonyms: 4633402C03Rik, 5730596K20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109168
VEGA: 19
Homologene: 9149
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 17,091,383 bp (GRCm38)
  • T to C, chromosome 1 at 71,586,228 bp (GRCm38)
  • T to G, chromosome 1 at 83,061,176 bp (GRCm38)
  • A to G, chromosome 1 at 106,780,105 bp (GRCm38)
  • T to C, chromosome 1 at 123,341,703 bp (GRCm38)
  • T to A, chromosome 1 at 164,186,854 bp (GRCm38)
  • A to T, chromosome 2 at 20,661,938 bp (GRCm38)
  • T to C, chromosome 2 at 89,145,178 bp (GRCm38)
  • A to G, chromosome 2 at 111,961,032 bp (GRCm38)
  • A to G, chromosome 2 at 130,135,890 bp (GRCm38)
  • T to A, chromosome 2 at 145,876,517 bp (GRCm38)
  • A to G, chromosome 2 at 163,469,837 bp (GRCm38)
  • T to C, chromosome 2 at 170,114,870 bp (GRCm38)
  • C to A, chromosome 3 at 35,960,036 bp (GRCm38)
  • A to T, chromosome 3 at 59,330,483 bp (GRCm38)
  • T to A, chromosome 3 at 122,508,152 bp (GRCm38)
  • G to A, chromosome 4 at 43,545,694 bp (GRCm38)
  • T to C, chromosome 4 at 62,482,718 bp (GRCm38)
  • A to G, chromosome 4 at 96,641,285 bp (GRCm38)
  • A to G, chromosome 4 at 98,966,323 bp (GRCm38)
  • A to G, chromosome 4 at 147,581,285 bp (GRCm38)
  • A to G, chromosome 5 at 30,482,185 bp (GRCm38)
  • C to T, chromosome 5 at 65,272,508 bp (GRCm38)
  • C to T, chromosome 5 at 75,607,029 bp (GRCm38)
  • T to A, chromosome 5 at 107,620,426 bp (GRCm38)
  • T to C, chromosome 5 at 121,684,372 bp (GRCm38)
  • T to C, chromosome 6 at 83,107,161 bp (GRCm38)
  • A to T, chromosome 7 at 10,053,063 bp (GRCm38)
  • A to G, chromosome 7 at 12,771,730 bp (GRCm38)
  • T to C, chromosome 7 at 87,975,352 bp (GRCm38)
  • T to A, chromosome 7 at 90,443,805 bp (GRCm38)
  • T to G, chromosome 7 at 101,785,398 bp (GRCm38)
  • A to T, chromosome 7 at 105,126,400 bp (GRCm38)
  • C to A, chromosome 8 at 83,721,100 bp (GRCm38)
  • C to A, chromosome 9 at 8,900,846 bp (GRCm38)
  • G to A, chromosome 9 at 38,368,418 bp (GRCm38)
  • G to A, chromosome 9 at 39,550,212 bp (GRCm38)
  • A to T, chromosome 9 at 39,719,865 bp (GRCm38)
  • A to G, chromosome 9 at 40,092,927 bp (GRCm38)
  • A to C, chromosome 9 at 97,100,100 bp (GRCm38)
  • G to T, chromosome 9 at 107,945,791 bp (GRCm38)
  • GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG to GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG, chromosome 9 at 121,583,989 bp (GRCm38)
  • A to T, chromosome 10 at 60,407,389 bp (GRCm38)
  • T to A, chromosome 10 at 115,466,608 bp (GRCm38)
  • A to G, chromosome 10 at 127,041,292 bp (GRCm38)
  • A to T, chromosome 11 at 53,269,755 bp (GRCm38)
  • T to A, chromosome 11 at 74,630,019 bp (GRCm38)
  • A to G, chromosome 11 at 99,145,790 bp (GRCm38)
  • C to A, chromosome 11 at 102,606,090 bp (GRCm38)
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp (GRCm38)
  • A to G, chromosome 12 at 82,341,002 bp (GRCm38)
  • G to A, chromosome 12 at 101,893,548 bp (GRCm38)
  • A to T, chromosome 14 at 20,388,602 bp (GRCm38)
  • T to C, chromosome 14 at 32,835,684 bp (GRCm38)
  • A to G, chromosome 14 at 70,151,895 bp (GRCm38)
  • C to T, chromosome 15 at 4,917,074 bp (GRCm38)
  • C to T, chromosome 15 at 12,154,542 bp (GRCm38)
  • A to G, chromosome 15 at 65,897,780 bp (GRCm38)
  • T to C, chromosome 15 at 85,844,458 bp (GRCm38)
  • A to T, chromosome 16 at 14,207,577 bp (GRCm38)
  • T to C, chromosome 16 at 56,155,268 bp (GRCm38)
  • G to T, chromosome 16 at 94,370,722 bp (GRCm38)
  • A to T, chromosome 17 at 21,314,398 bp (GRCm38)
  • A to T, chromosome 17 at 25,963,435 bp (GRCm38)
  • T to A, chromosome 17 at 35,425,316 bp (GRCm38)
  • T to C, chromosome 17 at 84,231,156 bp (GRCm38)
  • A to G, chromosome 18 at 75,471,954 bp (GRCm38)
  • C to T, chromosome 19 at 4,738,190 bp (GRCm38)
  • A to G, chromosome 19 at 7,532,188 bp (GRCm38)
  • G to A, chromosome 19 at 10,967,087 bp (GRCm38)
  • A to G, chromosome 19 at 12,901,138 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9631 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069424-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.