Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9638Btlr/Mmmh
Stock Number:
069431-MU
Citation ID:
RRID:MMRRC_069431-MU
Other Names:
R9638 (G1)
Major Collection:

Strain Information

Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Abca1
Name: ATP-binding cassette, sub-family A member 1
Synonyms: ABC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Dtna
Name: dystrobrevin alpha
Synonyms: alpha-dystrobrevin, A0, 87K protein, Dtn, adbn, a-DB-1, 2210407P21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13527
VEGA: 18
HGNC: HGNC:3057
Homologene: 20362
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nix, D14Ertd719e, Nip3L
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Ptk7
Name: PTK7 protein tyrosine kinase 7
Synonyms: 8430404F20Rik, mPTK7/CCK4, chz
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71461
VEGA: 17
HGNC: HGNC:9618
Homologene: 43672
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: ZF5, Zfp161, b2b1982Clo
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Rpn2
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20014
Homologene: 2214
Ddx3y
Name: DEAD box helicase 3, Y-linked
Synonyms: Dby, 8030469F12Rik, D1Pas1-rs1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 26900
HGNC: HGNC:2699
Homologene: 55839
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: JNK-interacting protein 3, Jip3, JSAP1, JUN/SAPK-associated protein 1, JSAP1d, JSAP1c, JSAP1b, JSAP1a, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, sunday driver 2, Syd2, D17Wsu15e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Paxbp1
Name: PAX3 and PAX7 binding protein 1
Synonyms: 1810007M14Rik, Pax3/7bp, Gcfc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67367
Homologene: 9604
Palld
Name: palladin, cytoskeletal associated protein
Synonyms: 2410003B16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72333
Homologene: 75052
Supt3
Name: SPT3, SAGA and STAGA complex component
Synonyms: SPT3L, SPT3, 2310066G22Rik, Supt3h
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 109115
Homologene: 121570
Pot1a
Name: protection of telomeres 1A
Synonyms: 1500031H18Rik, Pot1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101185
Homologene: 32263
Sema4a
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms: SemB, SemB, Semab
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20351
Homologene: 8425
Isx
Name: intestine specific homeobox
Synonyms: 9130012O13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71597
Homologene: 28312
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Fli1
Name: Friend leukemia integration 1
Synonyms: Sic1, SIC-1, EWSR2, Fli-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14247
HGNC: HGNC:3749
Homologene: 55624
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Mef2b
Name: myocyte enhancer factor 2B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17259
Homologene: 48381
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Efa6, 1110007H17Rik, Psdl, Efa6a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, Apg9l2, eONE, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Or2b4
Name: olfactory receptor family 2 subfamily B member 4
Synonyms: MOR256-3, GA_x6K02T2PSCP-2264806-2265753, A3, Olfr124, SR1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 259064
Homologene: 74266
Gimap6
Name: GTPase, IMAP family member 6
Synonyms: 4833419H03Rik, Ian6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231931
Homologene: 11670
Krt81
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64818
VEGA: 15
HGNC: HGNC:6458
Homologene: 55645
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231293
Homologene: 5474
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
F830016B08Rik
Name: RIKEN cDNA F830016B08 gene
Synonyms: Ifgga4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240328
VEGA: 18
Homologene: 129714
Rimklb
Name: ribosomal modification protein rimK-like family member B
Synonyms: 4931417E21Rik, 4933426K21Rik, NAAGS
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108653
Homologene: 18968
Upf3a
Name: UPF3 regulator of nonsense transcripts homolog A (yeast)
Synonyms: 4930546M19Rik, RENT3A, UPF3, 2600001C03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67031
Homologene: 23395
Or1e23
Name: olfactory receptor family 1 subfamily E member 23
Synonyms: GA_x6K02T2P1NL-3676608-3675670, MOR135-14, MOR135-31_p, Olfr382
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258435
Homologene: 17252
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Ptger4
Name: prostaglandin E receptor 4 (subtype EP4)
Synonyms: Ptgerep4, EP4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19219
HGNC: HGNC:9596
Homologene: 20261
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
Homologene: 117484
Cdh10
Name: cadherin 10
Synonyms: T2-cadherin, A830016G23Rik, C030003B10Rik, C030011H18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320873
HGNC: HGNC:1749
Homologene: 68530
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Fam161b
Name: family with sequence similarity 161, member B
Synonyms: 9830169C18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217705
Homologene: 17581
Or51f1d
Name: olfactory receptor family 51 subfamily F member 1D
Synonyms: GA_x6K02T2PBJ9-5762668-5763618, MOR14-6, Olfr583
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258752
Homologene: 133721
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Ighv4-1
Name: immunoglobulin heavy variable 4-1
Synonyms: Gm16612
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780802
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 2 at 84,880,416 bp (GRCm38)
  • A to T, chromosome 2 at 157,283,646 bp (GRCm38)
  • T to C, chromosome 2 at 165,146,767 bp (GRCm38)
  • T to A, chromosome 3 at 85,661,084 bp (GRCm38)
  • T to A, chromosome 3 at 88,449,759 bp (GRCm38)
  • T to G, chromosome 4 at 53,092,806 bp (GRCm38)
  • C to T, chromosome 4 at 84,414,255 bp (GRCm38)
  • T to A, chromosome 4 at 139,644,116 bp (GRCm38)
  • T to C, chromosome 5 at 24,391,408 bp (GRCm38)
  • T to A, chromosome 5 at 73,408,143 bp (GRCm38)
  • C to A, chromosome 5 at 135,725,761 bp (GRCm38)
  • G to A, chromosome 6 at 25,750,107 bp (GRCm38)
  • A to G, chromosome 6 at 48,702,490 bp (GRCm38)
  • A to T, chromosome 6 at 122,456,599 bp (GRCm38)
  • T to C, chromosome 7 at 103,051,811 bp (GRCm38)
  • A to T, chromosome 7 at 139,629,847 bp (GRCm38)
  • G to A, chromosome 8 at 13,798,343 bp (GRCm38)
  • A to G, chromosome 8 at 61,549,754 bp (GRCm38)
  • ACCCTCACCC to ACC, chromosome 8 at 70,166,856 bp (GRCm38)
  • T to C, chromosome 8 at 74,892,938 bp (GRCm38)
  • T to A, chromosome 8 at 93,079,906 bp (GRCm38)
  • T to A, chromosome 9 at 18,639,330 bp (GRCm38)
  • T to C, chromosome 9 at 32,476,724 bp (GRCm38)
  • C to A, chromosome 10 at 41,561,163 bp (GRCm38)
  • A to G, chromosome 11 at 73,517,049 bp (GRCm38)
  • T to C, chromosome 12 at 70,020,844 bp (GRCm38)
  • T to C, chromosome 12 at 84,356,413 bp (GRCm38)
  • T to G, chromosome 12 at 113,948,284 bp (GRCm38)
  • G to A, chromosome 14 at 67,008,765 bp (GRCm38)
  • G to T, chromosome 14 at 103,541,973 bp (GRCm38)
  • A to G, chromosome 15 at 5,235,212 bp (GRCm38)
  • T to A, chromosome 15 at 18,964,215 bp (GRCm38)
  • T to C, chromosome 15 at 101,460,975 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • G to A, chromosome 16 at 31,887,591 bp (GRCm38)
  • C to A, chromosome 16 at 91,034,993 bp (GRCm38)
  • T to A, chromosome 16 at 91,034,994 bp (GRCm38)
  • A to T, chromosome 17 at 21,397,794 bp (GRCm38)
  • T to C, chromosome 17 at 24,899,049 bp (GRCm38)
  • G to A, chromosome 17 at 37,805,618 bp (GRCm38)
  • A to G, chromosome 17 at 44,923,246 bp (GRCm38)
  • A to G, chromosome 17 at 46,579,593 bp (GRCm38)
  • A to G, chromosome 17 at 67,632,231 bp (GRCm38)
  • G to A, chromosome 17 at 69,388,380 bp (GRCm38)
  • A to T, chromosome 18 at 23,611,065 bp (GRCm38)
  • A to G, chromosome 18 at 60,299,884 bp (GRCm38)
  • T to A, chromosome 19 at 20,636,736 bp (GRCm38)
  • GCC to GC, chromosome 19 at 46,313,402 bp (GRCm38)
  • C to T, chromosome Y at 1,263,599 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9638 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069431-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.