Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9638Btlr/Mmmh
Stock Number:
069431-MU
Citation ID:
RRID:MMRRC_069431-MU
Other Names:
R9638 (G1)
Major Collection:

Strain Information

Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Abca1
Name: ATP-binding cassette, sub-family A member 1
Synonyms: ABC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: Ahd-1, Ssdh1, ALDH4, A930035F14Rik, Ahd1, P5CDH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Dtna
Name: dystrobrevin alpha
Synonyms: alpha-dystrobrevin, A0, 87K protein, Dtn, adbn, a-DB-1, 2210407P21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13527
VEGA: 18
HGNC: HGNC:3057
Homologene: 20362
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nix, D14Ertd719e, Nip3L
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 2 at 84,880,416 bp (GRCm38)
  • A to T, chromosome 2 at 157,283,646 bp (GRCm38)
  • T to C, chromosome 2 at 165,146,767 bp (GRCm38)
  • T to A, chromosome 3 at 85,661,084 bp (GRCm38)
  • T to A, chromosome 3 at 88,449,759 bp (GRCm38)
  • T to G, chromosome 4 at 53,092,806 bp (GRCm38)
  • C to T, chromosome 4 at 84,414,255 bp (GRCm38)
  • T to A, chromosome 4 at 139,644,116 bp (GRCm38)
  • T to C, chromosome 5 at 24,391,408 bp (GRCm38)
  • T to A, chromosome 5 at 73,408,143 bp (GRCm38)
  • C to A, chromosome 5 at 135,725,761 bp (GRCm38)
  • G to A, chromosome 6 at 25,750,107 bp (GRCm38)
  • A to G, chromosome 6 at 48,702,490 bp (GRCm38)
  • A to T, chromosome 6 at 122,456,599 bp (GRCm38)
  • T to C, chromosome 7 at 103,051,811 bp (GRCm38)
  • A to T, chromosome 7 at 139,629,847 bp (GRCm38)
  • G to A, chromosome 8 at 13,798,343 bp (GRCm38)
  • A to G, chromosome 8 at 61,549,754 bp (GRCm38)
  • ACCCTCACCC to ACC, chromosome 8 at 70,166,856 bp (GRCm38)
  • T to C, chromosome 8 at 74,892,938 bp (GRCm38)
  • T to A, chromosome 8 at 93,079,906 bp (GRCm38)
  • T to A, chromosome 9 at 18,639,330 bp (GRCm38)
  • T to C, chromosome 9 at 32,476,724 bp (GRCm38)
  • C to A, chromosome 10 at 41,561,163 bp (GRCm38)
  • A to G, chromosome 11 at 73,517,049 bp (GRCm38)
  • T to C, chromosome 12 at 70,020,844 bp (GRCm38)
  • T to C, chromosome 12 at 84,356,413 bp (GRCm38)
  • T to G, chromosome 12 at 113,948,284 bp (GRCm38)
  • G to A, chromosome 14 at 67,008,765 bp (GRCm38)
  • G to T, chromosome 14 at 103,541,973 bp (GRCm38)
  • A to G, chromosome 15 at 5,235,212 bp (GRCm38)
  • T to A, chromosome 15 at 18,964,215 bp (GRCm38)
  • T to C, chromosome 15 at 101,460,975 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • G to A, chromosome 16 at 31,887,591 bp (GRCm38)
  • C to A, chromosome 16 at 91,034,993 bp (GRCm38)
  • T to A, chromosome 16 at 91,034,994 bp (GRCm38)
  • A to T, chromosome 17 at 21,397,794 bp (GRCm38)
  • T to C, chromosome 17 at 24,899,049 bp (GRCm38)
  • G to A, chromosome 17 at 37,805,618 bp (GRCm38)
  • A to G, chromosome 17 at 44,923,246 bp (GRCm38)
  • A to G, chromosome 17 at 46,579,593 bp (GRCm38)
  • A to G, chromosome 17 at 67,632,231 bp (GRCm38)
  • G to A, chromosome 17 at 69,388,380 bp (GRCm38)
  • A to T, chromosome 18 at 23,611,065 bp (GRCm38)
  • A to G, chromosome 18 at 60,299,884 bp (GRCm38)
  • T to A, chromosome 19 at 20,636,736 bp (GRCm38)
  • GCC to GC, chromosome 19 at 46,313,402 bp (GRCm38)
  • C to T, chromosome Y at 1,263,599 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9638 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069431-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.