Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9659Btlr/Mmmh
Stock Number:
069452-MU
Citation ID:
RRID:MMRRC_069452-MU
Other Names:
R9659 (G1)
Major Collection:

Strain Information

Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: protein kinase U-alpha, PKUalpha, 4933403M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24086
Homologene: 4993
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 6,248,449 bp (GRCm38)
  • G to T, chromosome 1 at 28,777,455 bp (GRCm38)
  • A to G, chromosome 1 at 121,527,699 bp (GRCm38)
  • T to C, chromosome 1 at 175,658,519 bp (GRCm38)
  • T to A, chromosome 1 at 189,854,977 bp (GRCm38)
  • T to A, chromosome 2 at 37,201,885 bp (GRCm38)
  • C to A, chromosome 2 at 60,338,321 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • T to C, chromosome 2 at 79,392,978 bp (GRCm38)
  • T to C, chromosome 2 at 181,240,232 bp (GRCm38)
  • T to C, chromosome 3 at 63,773,715 bp (GRCm38)
  • T to C, chromosome 3 at 64,134,521 bp (GRCm38)
  • G to A, chromosome 3 at 108,469,981 bp (GRCm38)
  • G to A, chromosome 4 at 62,416,059 bp (GRCm38)
  • T to G, chromosome 4 at 120,667,346 bp (GRCm38)
  • T to C, chromosome 5 at 71,034,797 bp (GRCm38)
  • T to C, chromosome 5 at 112,874,516 bp (GRCm38)
  • T to C, chromosome 5 at 115,173,128 bp (GRCm38)
  • T to G, chromosome 5 at 123,115,725 bp (GRCm38)
  • T to C, chromosome 5 at 130,379,035 bp (GRCm38)
  • T to G, chromosome 5 at 137,365,481 bp (GRCm38)
  • A to G, chromosome 6 at 9,247,418 bp (GRCm38)
  • T to G, chromosome 6 at 78,383,591 bp (GRCm38)
  • T to G, chromosome 6 at 116,305,627 bp (GRCm38)
  • T to C, chromosome 7 at 17,090,599 bp (GRCm38)
  • C to T, chromosome 7 at 30,056,538 bp (GRCm38)
  • T to C, chromosome 7 at 108,081,538 bp (GRCm38)
  • T to C, chromosome 7 at 141,645,833 bp (GRCm38)
  • C to G, chromosome 8 at 56,319,040 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • A to G, chromosome 8 at 88,319,105 bp (GRCm38)
  • C to A, chromosome 9 at 15,322,550 bp (GRCm38)
  • A to G, chromosome 9 at 38,995,000 bp (GRCm38)
  • T to C, chromosome 9 at 65,833,420 bp (GRCm38)
  • A to C, chromosome 9 at 66,399,903 bp (GRCm38)
  • T to A, chromosome 9 at 105,933,835 bp (GRCm38)
  • C to T, chromosome 10 at 18,165,599 bp (GRCm38)
  • A to G, chromosome 10 at 88,817,309 bp (GRCm38)
  • A to G, chromosome 10 at 89,478,776 bp (GRCm38)
  • A to G, chromosome 11 at 6,396,814 bp (GRCm38)
  • T to C, chromosome 11 at 69,734,828 bp (GRCm38)
  • T to A, chromosome 11 at 71,182,306 bp (GRCm38)
  • G to T, chromosome 11 at 80,089,716 bp (GRCm38)
  • T to C, chromosome 11 at 105,240,437 bp (GRCm38)
  • A to T, chromosome 12 at 65,226,569 bp (GRCm38)
  • A to T, chromosome 13 at 62,371,910 bp (GRCm38)
  • A to G, chromosome 13 at 89,691,741 bp (GRCm38)
  • T to A, chromosome 13 at 120,264,218 bp (GRCm38)
  • A to G, chromosome 14 at 44,103,248 bp (GRCm38)
  • A to G, chromosome 14 at 50,320,724 bp (GRCm38)
  • A to G, chromosome 14 at 60,846,444 bp (GRCm38)
  • A to T, chromosome 15 at 37,984,010 bp (GRCm38)
  • A to G, chromosome 15 at 81,621,072 bp (GRCm38)
  • A to G, chromosome 16 at 34,721,543 bp (GRCm38)
  • A to G, chromosome 16 at 97,922,273 bp (GRCm38)
  • T to G, chromosome 17 at 37,771,989 bp (GRCm38)
  • T to A, chromosome 17 at 84,547,464 bp (GRCm38)
  • C to G, chromosome 18 at 58,209,582 bp (GRCm38)
  • AGAGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGCAGACAGCAGGTGCTCACTGAGGCCTG to AGAGGCCTG, chromosome 18 at 80,089,561 bp (GRCm38)
  • G to A, chromosome 19 at 7,786,433 bp (GRCm38)
  • A to G, chromosome 19 at 17,477,881 bp (GRCm38)
  • A to G, chromosome 19 at 58,453,220 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9659 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069452-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.