Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9668Btlr/Mmmh
Stock Number:
069461-MU
Citation ID:
RRID:MMRRC_069461-MU
Other Names:
R9668 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Kpna2
Name: karyopherin subunit alpha 2
Synonyms: pendulin, m-importin, m-importin-alpha-P1, Rch1, 2410044B12Rik, Importin alpha, importin alpha 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16647
HGNC: HGNC:6395
Homologene: 1708
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103468
VEGA: 10
Homologene: 5555
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2610034F17Rik, 2810422B04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69956
Homologene: 41211
Cd320
Name: CD320 antigen
Synonyms: NG29, D17Ertd716e, 8D6, VLDL, 425O18-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54219
Homologene: 9573
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2b, NZF-2a, Nzf2, Nztf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Fezf1
Name: Fez family zinc finger 1
Synonyms: Zfp312-like, Fez, 3110069A13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73191
Homologene: 19252
Tars1
Name: threonyl-tRNA synthetase 1
Synonyms: ThrRS, D15Wsu59e, Tars
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110960
VEGA: 15
Homologene: 11852
Atp5pb
Name: ATP synthase peripheral stalk-membrane subunit b
Synonyms: C76477, Atp5f1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11950
HGNC: HGNC:840
Homologene: 1275
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14255
HGNC: HGNC:3765
Homologene: 3040
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Chrne
Name: cholinergic receptor, nicotinic, epsilon polypeptide
Synonyms: Acre, AChrepsilon
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11448
HGNC: HGNC:1966
Homologene: 60
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Zfp839
Name: zinc finger protein 839
Synonyms: 2810455K09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72805
VEGA: 12
Homologene: 49541
Nckap1l
Name: NCK associated protein 1 like
Synonyms: 4930568P13Rik, Hem1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105855
VEGA: 15
HGNC: HGNC:4862
Homologene: 3901
Or4a80
Name: olfactory receptor family 4 subfamily A member 80
Synonyms: GA_x6K02T2Q125-51193814-51192857, MOR231-19P, MOR231-19P, MOR231-18, Olfr1253-ps1, Olfr1559-ps1, Olfr1253
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258370
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Pik3r2
Name: phosphoinositide-3-kinase regulatory subunit 2
Synonyms: p85beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18709
HGNC: HGNC:8980
Homologene: 3687
Cdc16
Name: CDC16 cell division cycle 16
Synonyms: 2810431D22Rik, 2700071J12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69957
HGNC: HGNC:1720
Homologene: 2899
Slc38a7
Name: solute carrier family 38, member 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234595
Homologene: 41237
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Tcaf3
Name: TRPM8 channel-associated factor 3
Synonyms: Eapa2, Fam115e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 403088
Homologene: 74374
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Meak7
Name: MTOR associated protein, eak-7 homolog
Synonyms: 4632415K11Rik, Tldc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74347
Homologene: 32494
Sh3rf2
Name: SH3 domain containing ring finger 2
Synonyms: RNF158, 9130023G24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269016
Homologene: 17618
Nr1i2
Name: nuclear receptor subfamily 1, group I, member 2
Synonyms: PXR.2, PXR.1, Pregnane X receptor, mPXR, PXR, SXR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18171
HGNC: HGNC:7968
Homologene: 40757
Acp7
Name: acid phosphatase 7, tartrate resistant
Synonyms: C330005M16Rik, Papl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101744
Homologene: 23924
Mief2
Name: mitochondrial elongation factor 2
Synonyms: LOC237781, Smcr7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237781
Homologene: 27354
Gmppb
Name: GDP-mannose pyrophosphorylase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331026
Homologene: 5578
Ankrd13b
Name: ankyrin repeat domain 13b
Synonyms: B930093C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268445
Homologene: 27367
Mfsd4a
Name: major facilitator superfamily domain containing 4A
Synonyms: A930031D07Rik, Mfsd4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213006
Homologene: 45419
Or10x4
Name: olfactory receptor family 10 subfamily X member 4
Synonyms: GA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415, Olfr248
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258709
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Stxbp6
Name: syntaxin binding protein 6 (amisyn)
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217517
Homologene: 8579
Syne3
Name: spectrin repeat containing, nuclear envelope family member 3
Synonyms: nesprin-3beta, nesprin-3alpha, nesprin-3, 4831426I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 212073
VEGA: 12
Homologene: 17625
Naprt
Name: nicotinate phosphoribosyltransferase
Synonyms: 9130210N20Rik, Naprt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223646
VEGA: 15
Homologene: 82285
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
C2cd2
Name: C2 calcium-dependent domain containing 2
Synonyms: ORF25, 5830404H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207781
VEGA: 16
HGNC: HGNC:1266
Homologene: 18368
Zfp707
Name: zinc finger protein 707
Synonyms: 1500031N24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69020
Homologene: 18364
Acox1
Name: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: Acyl-CoA oxidase, AOX, D130055E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11430
HGNC: HGNC:119
Homologene: 38299
Or10j2
Name: olfactory receptor family 10 subfamily J member 2
Synonyms: GA_x6K02T2P20D-20826777-20827719, GA_x6K02T2R7CC-581296-580364, MOR267-12P, MOR267-8, Olfr1403, Olfr418-ps1, Olfr418
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258645
HGNC: HGNC:8175
Homologene: 8218
Rnf217
Name: ring finger protein 217
Synonyms: Ibrdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268291
Homologene: 66368
Or1l4b
Name: olfactory receptor family 1 subfamily L member 4B
Synonyms: GA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7, Olfr364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227794
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Ppp1r42
Name: protein phosphatase 1, regulatory subunit 42
Synonyms: 1700011J18Rik, 4930418G15Rik, Lrrc67
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69312
Homologene: 27077
Trim72
Name: tripartite motif-containing 72
Synonyms: MG53, mitsugumin 53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434246
Homologene: 66924
Mettl5
Name: methyltransferase 5, N6-adenosine
Synonyms: 2810410A08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75422
Homologene: 8570
Gm6309
Name: predicted gene 6309
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622306
Homologene: 86127
Selp
Name: selectin, platelet
Synonyms: CD62P, P-selectin, Grmp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20344
Homologene: 2260
Tmem70
Name: transmembrane protein 70
Synonyms: 2210416J16Rik, 1110020A09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70397
Homologene: 9890
Dpf1
Name: double PHD fingers 1
Synonyms: neuro-d4, Neud4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29861
Homologene: 3415
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Or1e28
Name: olfactory receptor family 1 subfamily E member 28
Synonyms: GA_x6K02T2P1NL-3884648-3883708, MOR135-22, Or1e28-ps1, Olfr388-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258182
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 10,003,338 bp (GRCm38)
  • A to C, chromosome 1 at 16,665,435 bp (GRCm38)
  • A to G, chromosome 1 at 67,174,490 bp (GRCm38)
  • C to T, chromosome 1 at 132,041,890 bp (GRCm38)
  • G to T, chromosome 1 at 150,743,741 bp (GRCm38)
  • A to T, chromosome 1 at 164,141,406 bp (GRCm38)
  • G to A, chromosome 1 at 173,270,616 bp (GRCm38)
  • A to T, chromosome 1 at 174,391,332 bp (GRCm38)
  • T to G, chromosome 2 at 37,146,506 bp (GRCm38)
  • A to T, chromosome 2 at 41,185,970 bp (GRCm38)
  • C to T, chromosome 2 at 69,881,379 bp (GRCm38)
  • T to G, chromosome 2 at 89,752,292 bp (GRCm38)
  • T to G, chromosome 2 at 111,269,942 bp (GRCm38)
  • C to T, chromosome 2 at 181,810,342 bp (GRCm38)
  • C to T, chromosome 3 at 105,956,040 bp (GRCm38)
  • C to T, chromosome 4 at 126,323,651 bp (GRCm38)
  • A to G, chromosome 5 at 146,168,216 bp (GRCm38)
  • G to A, chromosome 5 at 147,356,884 bp (GRCm38)
  • G to T, chromosome 5 at 150,358,853 bp (GRCm38)
  • T to C, chromosome 6 at 23,247,575 bp (GRCm38)
  • A to T, chromosome 6 at 42,589,702 bp (GRCm38)
  • A to T, chromosome 6 at 71,894,291 bp (GRCm38)
  • T to A, chromosome 7 at 28,615,137 bp (GRCm38)
  • C to T, chromosome 7 at 29,309,659 bp (GRCm38)
  • G to A, chromosome 7 at 67,147,690 bp (GRCm38)
  • C to A, chromosome 7 at 128,009,920 bp (GRCm38)
  • C to A, chromosome 7 at 144,610,842 bp (GRCm38)
  • T to A, chromosome 8 at 13,767,552 bp (GRCm38)
  • A to T, chromosome 8 at 16,211,758 bp (GRCm38)
  • A to G, chromosome 8 at 70,768,815 bp (GRCm38)
  • G to T, chromosome 8 at 95,844,144 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to C, chromosome 8 at 119,761,775 bp (GRCm38)
  • G to A, chromosome 9 at 79,639,678 bp (GRCm38)
  • T to C, chromosome 9 at 100,994,581 bp (GRCm38)
  • T to G, chromosome 9 at 108,051,163 bp (GRCm38)
  • A to T, chromosome 10 at 11,206,332 bp (GRCm38)
  • A to G, chromosome 10 at 13,128,722 bp (GRCm38)
  • A to G, chromosome 10 at 31,608,406 bp (GRCm38)
  • A to T, chromosome 10 at 117,774,478 bp (GRCm38)
  • A to G, chromosome 11 at 60,731,248 bp (GRCm38)
  • A to G, chromosome 11 at 70,616,953 bp (GRCm38)
  • A to G, chromosome 11 at 73,724,832 bp (GRCm38)
  • T to A, chromosome 11 at 77,477,768 bp (GRCm38)
  • G to A, chromosome 11 at 106,990,715 bp (GRCm38)
  • G to T, chromosome 11 at 116,198,311 bp (GRCm38)
  • G to T, chromosome 12 at 44,902,957 bp (GRCm38)
  • A to G, chromosome 12 at 104,932,209 bp (GRCm38)
  • G to A, chromosome 12 at 110,855,846 bp (GRCm38)
  • C to T, chromosome 13 at 49,687,409 bp (GRCm38)
  • T to A, chromosome 13 at 98,777,457 bp (GRCm38)
  • T to A, chromosome 15 at 11,394,360 bp (GRCm38)
  • C to T, chromosome 15 at 59,346,213 bp (GRCm38)
  • C to A, chromosome 15 at 75,893,432 bp (GRCm38)
  • C to A, chromosome 15 at 75,975,236 bp (GRCm38)
  • A to T, chromosome 15 at 79,642,243 bp (GRCm38)
  • T to C, chromosome 15 at 89,826,932 bp (GRCm38)
  • C to T, chromosome 15 at 103,473,850 bp (GRCm38)
  • A to G, chromosome 16 at 38,251,211 bp (GRCm38)
  • A to G, chromosome 16 at 97,870,218 bp (GRCm38)
  • G to A, chromosome 17 at 33,846,139 bp (GRCm38)
  • A to T, chromosome 18 at 37,742,508 bp (GRCm38)
  • T to A, chromosome 18 at 42,111,282 bp (GRCm38)
  • T to A, chromosome Y at 943,075 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9668 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069461-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.