Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9668Btlr/Mmmh
Stock Number:
069461-MU
Citation ID:
RRID:MMRRC_069461-MU
Other Names:
R9668 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Kpna2
Name: karyopherin subunit alpha 2
Synonyms: pendulin, m-importin, m-importin-alpha-P1, Rch1, 2410044B12Rik, Importin alpha, importin alpha 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16647
HGNC: HGNC:6395
Homologene: 1708
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Nup107
Name: nucleoporin 107
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103468
VEGA: 10
Homologene: 5555
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 10,003,338 bp (GRCm38)
  • A to C, chromosome 1 at 16,665,435 bp (GRCm38)
  • A to G, chromosome 1 at 67,174,490 bp (GRCm38)
  • C to T, chromosome 1 at 132,041,890 bp (GRCm38)
  • G to T, chromosome 1 at 150,743,741 bp (GRCm38)
  • A to T, chromosome 1 at 164,141,406 bp (GRCm38)
  • G to A, chromosome 1 at 173,270,616 bp (GRCm38)
  • A to T, chromosome 1 at 174,391,332 bp (GRCm38)
  • T to G, chromosome 2 at 37,146,506 bp (GRCm38)
  • A to T, chromosome 2 at 41,185,970 bp (GRCm38)
  • C to T, chromosome 2 at 69,881,379 bp (GRCm38)
  • T to G, chromosome 2 at 89,752,292 bp (GRCm38)
  • T to G, chromosome 2 at 111,269,942 bp (GRCm38)
  • C to T, chromosome 2 at 181,810,342 bp (GRCm38)
  • C to T, chromosome 3 at 105,956,040 bp (GRCm38)
  • C to T, chromosome 4 at 126,323,651 bp (GRCm38)
  • A to G, chromosome 5 at 146,168,216 bp (GRCm38)
  • G to A, chromosome 5 at 147,356,884 bp (GRCm38)
  • G to T, chromosome 5 at 150,358,853 bp (GRCm38)
  • T to C, chromosome 6 at 23,247,575 bp (GRCm38)
  • A to T, chromosome 6 at 42,589,702 bp (GRCm38)
  • A to T, chromosome 6 at 71,894,291 bp (GRCm38)
  • T to A, chromosome 7 at 28,615,137 bp (GRCm38)
  • C to T, chromosome 7 at 29,309,659 bp (GRCm38)
  • G to A, chromosome 7 at 67,147,690 bp (GRCm38)
  • C to A, chromosome 7 at 128,009,920 bp (GRCm38)
  • C to A, chromosome 7 at 144,610,842 bp (GRCm38)
  • T to A, chromosome 8 at 13,767,552 bp (GRCm38)
  • A to T, chromosome 8 at 16,211,758 bp (GRCm38)
  • A to G, chromosome 8 at 70,768,815 bp (GRCm38)
  • G to T, chromosome 8 at 95,844,144 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to C, chromosome 8 at 119,761,775 bp (GRCm38)
  • G to A, chromosome 9 at 79,639,678 bp (GRCm38)
  • T to C, chromosome 9 at 100,994,581 bp (GRCm38)
  • T to G, chromosome 9 at 108,051,163 bp (GRCm38)
  • A to T, chromosome 10 at 11,206,332 bp (GRCm38)
  • A to G, chromosome 10 at 13,128,722 bp (GRCm38)
  • A to G, chromosome 10 at 31,608,406 bp (GRCm38)
  • A to T, chromosome 10 at 117,774,478 bp (GRCm38)
  • A to G, chromosome 11 at 60,731,248 bp (GRCm38)
  • A to G, chromosome 11 at 70,616,953 bp (GRCm38)
  • A to G, chromosome 11 at 73,724,832 bp (GRCm38)
  • T to A, chromosome 11 at 77,477,768 bp (GRCm38)
  • G to A, chromosome 11 at 106,990,715 bp (GRCm38)
  • G to T, chromosome 11 at 116,198,311 bp (GRCm38)
  • G to T, chromosome 12 at 44,902,957 bp (GRCm38)
  • A to G, chromosome 12 at 104,932,209 bp (GRCm38)
  • G to A, chromosome 12 at 110,855,846 bp (GRCm38)
  • C to T, chromosome 13 at 49,687,409 bp (GRCm38)
  • T to A, chromosome 13 at 98,777,457 bp (GRCm38)
  • T to A, chromosome 15 at 11,394,360 bp (GRCm38)
  • C to T, chromosome 15 at 59,346,213 bp (GRCm38)
  • C to A, chromosome 15 at 75,893,432 bp (GRCm38)
  • C to A, chromosome 15 at 75,975,236 bp (GRCm38)
  • A to T, chromosome 15 at 79,642,243 bp (GRCm38)
  • T to C, chromosome 15 at 89,826,932 bp (GRCm38)
  • C to T, chromosome 15 at 103,473,850 bp (GRCm38)
  • A to G, chromosome 16 at 38,251,211 bp (GRCm38)
  • A to G, chromosome 16 at 97,870,218 bp (GRCm38)
  • G to A, chromosome 17 at 33,846,139 bp (GRCm38)
  • A to T, chromosome 18 at 37,742,508 bp (GRCm38)
  • T to A, chromosome 18 at 42,111,282 bp (GRCm38)
  • T to A, chromosome Y at 943,075 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9668 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069461-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.