Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9675Btlr/Mmmh
Stock Number:
069468-MU
Citation ID:
RRID:MMRRC_069468-MU
Other Names:
R9675 (G1)
Major Collection:

Strain Information

Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, Tslc1, SynCam, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Brd4
Name: bromodomain containing 4
Synonyms: MCAP, HUNK1, WI-11513
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57261
Homologene: 136213
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Rasgrp1
Name: RAS guanyl releasing protein 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19419
HGNC: HGNC:9878
Homologene: 4195
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 31,223,563 bp (GRCm38)
  • C to A, chromosome 1 at 34,806,027 bp (GRCm38)
  • T to C, chromosome 1 at 39,325,365 bp (GRCm38)
  • G to A, chromosome 2 at 70,585,856 bp (GRCm38)
  • T to C, chromosome 2 at 103,708,187 bp (GRCm38)
  • T to C, chromosome 2 at 110,362,150 bp (GRCm38)
  • T to A, chromosome 2 at 117,342,709 bp (GRCm38)
  • T to G, chromosome 2 at 120,806,760 bp (GRCm38)
  • A to G, chromosome 2 at 121,256,608 bp (GRCm38)
  • C to T, chromosome 3 at 59,877,117 bp (GRCm38)
  • T to A, chromosome 3 at 126,438,116 bp (GRCm38)
  • T to C, chromosome 3 at 141,857,560 bp (GRCm38)
  • A to C, chromosome 4 at 86,243,752 bp (GRCm38)
  • A to G, chromosome 5 at 103,963,843 bp (GRCm38)
  • G to T, chromosome 5 at 113,191,961 bp (GRCm38)
  • T to C, chromosome 5 at 124,114,389 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • G to T, chromosome 6 at 24,876,636 bp (GRCm38)
  • A to G, chromosome 6 at 40,571,625 bp (GRCm38)
  • T to A, chromosome 7 at 3,620,982 bp (GRCm38)
  • T to C, chromosome 7 at 131,110,923 bp (GRCm38)
  • G to A, chromosome 8 at 34,807,810 bp (GRCm38)
  • C to T, chromosome 9 at 47,530,454 bp (GRCm38)
  • T to C, chromosome 9 at 101,101,356 bp (GRCm38)
  • T to A, chromosome 11 at 58,923,616 bp (GRCm38)
  • T to A, chromosome 11 at 70,650,206 bp (GRCm38)
  • TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC to TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC, chromosome 12 at 40,844,380 bp (GRCm38)
  • TGCCGG to TGCCGGAGCCGG, chromosome 12 at 40,844,394 bp (GRCm38)
  • A to T, chromosome 12 at 114,657,361 bp (GRCm38)
  • A to T, chromosome 13 at 61,356,557 bp (GRCm38)
  • A to G, chromosome 14 at 20,487,121 bp (GRCm38)
  • T to A, chromosome 15 at 76,268,320 bp (GRCm38)
  • T to C, chromosome 15 at 82,856,785 bp (GRCm38)
  • A to G, chromosome 16 at 97,951,745 bp (GRCm38)
  • A to T, chromosome 17 at 32,214,812 bp (GRCm38)
  • A to G, chromosome 17 at 78,378,740 bp (GRCm38)
  • A to G, chromosome 18 at 34,316,194 bp (GRCm38)
  • T to G, chromosome 19 at 13,781,275 bp (GRCm38)
  • A to T, chromosome 19 at 34,246,212 bp (GRCm38)
  • G to T, chromosome 19 at 44,149,257 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9675 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069468-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.