Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9675Btlr/Mmmh
Stock Number:
069468-MU
Citation ID:
RRID:MMRRC_069468-MU
Other Names:
R9675 (G1)
Major Collection:

Strain Information

Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, SynCam, Tslc1, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Brd4
Name: bromodomain containing 4
Synonyms: MCAP, HUNK1, WI-11513
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57261
Homologene: 136213
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Rasgrp1
Name: RAS guanyl releasing protein 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19419
HGNC: HGNC:9878
Homologene: 4195
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Tcf20
Name: transcription factor 20
Synonyms: SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21411
VEGA: 15
Homologene: 4131
Rnf167
Name: ring finger protein 167
Synonyms: 0610010G05Rik, 5730408C10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70510
Homologene: 41046
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243168
Homologene: 71549
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Dusp4
Name: dual specificity phosphatase 4
Synonyms: E130306H24Rik, 2700078F24Rik, MKP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319520
HGNC: HGNC:3070
Homologene: 1065
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Ogfod2
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms: 1300006G11Rik, 5730405M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66627
Homologene: 32588
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Mss51
Name: MSS51 mitochondrial translational activator
Synonyms: 4833444M15Rik, Zmynd17
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74843
VEGA: 14
Homologene: 27997
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Hyal5
Name: hyaluronoglucosaminidase 5
Synonyms: 4933439A12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74468
Homologene: 50610
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Tfpt
Name: TCF3 (E2A) fusion partner
Synonyms: 2400004F01Rik, Amida, FB1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69714
Homologene: 8349
Btnl10
Name: butyrophilin-like 10
Synonyms: BUTR-1, Butr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192194
Homologene: 138184
Fez2
Name: fasciculation and elongation protein zeta 2
Synonyms: zygin 2, D17Ertd315e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225020
HGNC: HGNC:3660
Homologene: 3742
Spatc1
Name: spermatogenesis and centriole associated 1
Synonyms: 1700084J23Rik, speriolin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74281
VEGA: 15
Homologene: 129861
Fibin
Name: fin bud initiation factor homolog (zebrafish)
Synonyms: Fibin, 1110018M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67606
Homologene: 12163
Msl2
Name: MSL complex subunit 2
Synonyms: E130103E02Rik, Rnf184, Msl2l1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77853
Homologene: 10021
Arsj
Name: arylsulfatase J
Synonyms: 9330196J05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 271970
Homologene: 35257
Pkd2l1
Name: polycystic kidney disease 2-like 1
Synonyms: polycystin-L, Pkdl, PCL, TRPP3, PKD2L
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329064
HGNC: HGNC:9011
Homologene: 22946
Cts7
Name: cathepsin 7
Synonyms: Epcs71, Epcs24, CTS1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56092
VEGA: 13
Homologene: 75110
Or1s2
Name: olfactory receptor family 1 subfamily S member 1
Synonyms: GA_x6K02T2RE5P-4112771-4113718, MOR127-1, Olfr1496
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258991
Homologene: 17458
Or9a4
Name: olfactory receptor family 9 subfamily A member 4
Synonyms: GA_x6K02T2P3E9-6947292-6946348, MOR120-2, Olfr460
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258381
Homologene: 64866
Dnaaf6rt
Name: dynein axonemal assembly factor 6, retrotransposed
Synonyms: 4930521A18Rik, Pih1d3, Dnaaf6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74708
Homologene: 16553
Npas2
Name: neuronal PAS domain protein 2
Synonyms: MOP4, bHLHe9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18143
HGNC: HGNC:7895
Homologene: 1887
Aadacl2fm3
Name: AADACL2 family member 3
Synonyms: Gm8298
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 666803
Homologene: 86204
Ighv1-15
Name: immunoglobulin heavy variable 1-15
Synonyms: Gm16858
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629865
HGNC: HGNC:5553
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 31,223,563 bp (GRCm38)
  • C to A, chromosome 1 at 34,806,027 bp (GRCm38)
  • T to C, chromosome 1 at 39,325,365 bp (GRCm38)
  • G to A, chromosome 2 at 70,585,856 bp (GRCm38)
  • T to C, chromosome 2 at 103,708,187 bp (GRCm38)
  • T to C, chromosome 2 at 110,362,150 bp (GRCm38)
  • T to A, chromosome 2 at 117,342,709 bp (GRCm38)
  • T to G, chromosome 2 at 120,806,760 bp (GRCm38)
  • A to G, chromosome 2 at 121,256,608 bp (GRCm38)
  • C to T, chromosome 3 at 59,877,117 bp (GRCm38)
  • T to A, chromosome 3 at 126,438,116 bp (GRCm38)
  • T to C, chromosome 3 at 141,857,560 bp (GRCm38)
  • A to C, chromosome 4 at 86,243,752 bp (GRCm38)
  • A to G, chromosome 5 at 103,963,843 bp (GRCm38)
  • G to T, chromosome 5 at 113,191,961 bp (GRCm38)
  • T to C, chromosome 5 at 124,114,389 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • G to T, chromosome 6 at 24,876,636 bp (GRCm38)
  • A to G, chromosome 6 at 40,571,625 bp (GRCm38)
  • T to A, chromosome 7 at 3,620,982 bp (GRCm38)
  • T to C, chromosome 7 at 131,110,923 bp (GRCm38)
  • G to A, chromosome 8 at 34,807,810 bp (GRCm38)
  • C to T, chromosome 9 at 47,530,454 bp (GRCm38)
  • T to C, chromosome 9 at 101,101,356 bp (GRCm38)
  • T to A, chromosome 11 at 58,923,616 bp (GRCm38)
  • T to A, chromosome 11 at 70,650,206 bp (GRCm38)
  • TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC to TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC, chromosome 12 at 40,844,380 bp (GRCm38)
  • TGCCGG to TGCCGGAGCCGG, chromosome 12 at 40,844,394 bp (GRCm38)
  • A to T, chromosome 12 at 114,657,361 bp (GRCm38)
  • A to T, chromosome 13 at 61,356,557 bp (GRCm38)
  • A to G, chromosome 14 at 20,487,121 bp (GRCm38)
  • T to A, chromosome 15 at 76,268,320 bp (GRCm38)
  • T to C, chromosome 15 at 82,856,785 bp (GRCm38)
  • A to G, chromosome 16 at 97,951,745 bp (GRCm38)
  • A to T, chromosome 17 at 32,214,812 bp (GRCm38)
  • A to G, chromosome 17 at 78,378,740 bp (GRCm38)
  • A to G, chromosome 18 at 34,316,194 bp (GRCm38)
  • T to G, chromosome 19 at 13,781,275 bp (GRCm38)
  • A to T, chromosome 19 at 34,246,212 bp (GRCm38)
  • G to T, chromosome 19 at 44,149,257 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9675 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069468-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.