Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9676Btlr/Mmmh
Stock Number:
069469-MU
Citation ID:
RRID:MMRRC_069469-MU
Other Names:
R9676 (G1)
Major Collection:

Strain Information

Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Eif4h
Name: eukaryotic translation initiation factor 4H
Synonyms: Wscr1, Eif4h, D5Ertd355e, E430026L18Rik, Wbscr1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22384
Homologene: 32536
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Niban2
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74374
Homologene: 71019
Rps15a
Name: ribosomal protein S15A
Synonyms: A630031B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 267019
Homologene: 128982
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Arhgef1
Name: Rho guanine nucleotide exchange factor 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Lrrn4cl
Name: LRRN4 C-terminal like
Synonyms: 1110067I12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68852
VEGA: 19
Homologene: 45730
Cand2
Name: cullin associated and neddylation dissociated 2 (putative)
Synonyms: Tp120b, 2210404G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67088
Homologene: 41657
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Plagl1
Name: pleiomorphic adenoma gene-like 1
Synonyms: Zac1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22634
HGNC: HGNC:9046
Homologene: 31401
Ifi206
Name: interferon activated gene 206
Synonyms: Gm4955, Pyblhin-C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102639543
HGNC: HGNC:5395
Homologene: 115929
Cldn10
Name: claudin 10
Synonyms: 6720456I16Rik, D14Ertd728e, Cldn10a, Cldn10b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58187
HGNC: HGNC:2033
Homologene: 5076
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Sh3rf2
Name: SH3 domain containing ring finger 2
Synonyms: RNF158, 9130023G24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269016
Homologene: 17618
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: Jaw1, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3, Lrmp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Srrm4
Name: serine/arginine repetitive matrix 4
Synonyms: fp, flopsy, B230202K19Rik, nSR100, 1500001A10Rik, bv
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68955
Homologene: 49869
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, MDR3, Pgp, Evi32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Or1j10
Name: olfactory receptor family 1 subfamily J member 10
Synonyms: GA_x6K02T2NLDC-33070879-33071799, MOR136-5, Olfr338
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258949
Homologene: 133647
Or2t47
Name: olfactory receptor family 2 subfamily T member 47
Synonyms: GA_x6K02T2NKPP-873285-874217, MOR275-2, Olfr328
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258495
Homologene: 133015
Ttc29
Name: tetratricopeptide repeat domain 29
Synonyms: 1700031F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73301
Homologene: 12918
Lpar3
Name: lysophosphatidic acid receptor 3
Synonyms: LPA3, Edg7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65086
Homologene: 8123
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Ddn
Name: dendrin
Synonyms: LOC328602
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13199
VEGA: 15
Homologene: 12816
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74189
Homologene: 14482
Or4a70
Name: olfactory receptor family 4 subfamily A member 70
Synonyms: GA_x6K02T2Q125-50937307-50936387, MOR231-5, Olfr1242
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258970
Homologene: 27316
Ciart
Name: circadian associated repressor of transcription
Synonyms: LOC229599, Gm129
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229599
Homologene: 79670
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 87,152,021 bp (GRCm38)
  • G to A, chromosome 1 at 173,481,152 bp (GRCm38)
  • G to A, chromosome 2 at 32,912,569 bp (GRCm38)
  • A to G, chromosome 2 at 36,376,836 bp (GRCm38)
  • T to C, chromosome 2 at 52,170,546 bp (GRCm38)
  • A to T, chromosome 2 at 89,493,436 bp (GRCm38)
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp (GRCm38)
  • G to T, chromosome 2 at 178,284,044 bp (GRCm38)
  • A to G, chromosome 3 at 95,878,902 bp (GRCm38)
  • T to C, chromosome 3 at 146,284,679 bp (GRCm38)
  • T to C, chromosome 4 at 88,355,445 bp (GRCm38)
  • T to C, chromosome 4 at 99,016,685 bp (GRCm38)
  • A to T, chromosome 5 at 8,664,548 bp (GRCm38)
  • A to G, chromosome 5 at 110,295,565 bp (GRCm38)
  • T to C, chromosome 5 at 116,446,722 bp (GRCm38)
  • G to A, chromosome 5 at 134,639,388 bp (GRCm38)
  • A to G, chromosome 6 at 115,792,161 bp (GRCm38)
  • T to G, chromosome 6 at 145,174,612 bp (GRCm38)
  • G to A, chromosome 7 at 24,926,076 bp (GRCm38)
  • T to C, chromosome 7 at 30,022,398 bp (GRCm38)
  • T to C, chromosome 7 at 87,037,244 bp (GRCm38)
  • G to T, chromosome 7 at 96,895,431 bp (GRCm38)
  • A to T, chromosome 7 at 118,115,138 bp (GRCm38)
  • A to G, chromosome 8 at 78,333,755 bp (GRCm38)
  • T to C, chromosome 10 at 13,128,211 bp (GRCm38)
  • T to A, chromosome 11 at 58,551,427 bp (GRCm38)
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp (GRCm38)
  • TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC to TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC, chromosome 12 at 40,844,380 bp (GRCm38)
  • TGCCGG to TGCCGGGGCCGG, chromosome 12 at 40,844,388 bp (GRCm38)
  • GGTGCC to GGTGCCTGTGCC, chromosome 12 at 40,844,398 bp (GRCm38)
  • CCGGTG to CCGGTGACGGTG, chromosome 12 at 40,844,402 bp (GRCm38)
  • T to C, chromosome 12 at 71,161,131 bp (GRCm38)
  • T to C, chromosome 12 at 79,284,185 bp (GRCm38)
  • A to T, chromosome 13 at 95,442,203 bp (GRCm38)
  • G to A, chromosome 14 at 72,472,227 bp (GRCm38)
  • G to T, chromosome 14 at 118,788,265 bp (GRCm38)
  • A to T, chromosome 15 at 98,805,371 bp (GRCm38)
  • C to A, chromosome 16 at 10,741,959 bp (GRCm38)
  • C to T, chromosome 18 at 42,149,795 bp (GRCm38)
  • T to A, chromosome 18 at 74,759,160 bp (GRCm38)
  • A to G, chromosome 19 at 8,852,132 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9676 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069469-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.