Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9680Btlr/Mmmh
Stock Number:
069473-MU
Citation ID:
RRID:MMRRC_069473-MU
Other Names:
R9680 (G1)
Major Collection:

Strain Information

Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Nap1l1
Name: nucleosome assembly protein 1-like 1
Synonyms: D10Ertd68e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53605
VEGA: 10
HGNC: HGNC:7637
Homologene: 129218
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Camk1g
Name: calcium/calmodulin-dependent protein kinase I gamma
Synonyms: CLICK-III, CaMKIgamma
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215303
Homologene: 48706
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 74,571,774 bp (GRCm38)
  • T to C, chromosome 1 at 119,608,074 bp (GRCm38)
  • T to A, chromosome 1 at 150,439,136 bp (GRCm38)
  • T to C, chromosome 1 at 158,782,248 bp (GRCm38)
  • T to A, chromosome 1 at 165,142,498 bp (GRCm38)
  • G to A, chromosome 1 at 177,131,073 bp (GRCm38)
  • G to T, chromosome 1 at 193,348,175 bp (GRCm38)
  • T to G, chromosome 2 at 82,988,928 bp (GRCm38)
  • A to T, chromosome 2 at 87,093,046 bp (GRCm38)
  • T to A, chromosome 2 at 121,302,384 bp (GRCm38)
  • T to C, chromosome 2 at 125,468,564 bp (GRCm38)
  • T to C, chromosome 2 at 152,082,098 bp (GRCm38)
  • T to A, chromosome 3 at 5,400,596 bp (GRCm38)
  • T to G, chromosome 3 at 72,956,288 bp (GRCm38)
  • C to T, chromosome 3 at 89,180,254 bp (GRCm38)
  • A to G, chromosome 3 at 90,461,141 bp (GRCm38)
  • A to G, chromosome 3 at 127,615,567 bp (GRCm38)
  • A to G, chromosome 4 at 21,873,586 bp (GRCm38)
  • T to A, chromosome 4 at 119,233,231 bp (GRCm38)
  • A to G, chromosome 4 at 130,221,734 bp (GRCm38)
  • A to G, chromosome 4 at 143,132,509 bp (GRCm38)
  • A to G, chromosome 4 at 148,271,644 bp (GRCm38)
  • A to T, chromosome 5 at 3,961,587 bp (GRCm38)
  • A to T, chromosome 5 at 44,032,942 bp (GRCm38)
  • T to A, chromosome 5 at 123,927,054 bp (GRCm38)
  • A to T, chromosome 5 at 137,735,578 bp (GRCm38)
  • A to G, chromosome 5 at 144,737,423 bp (GRCm38)
  • A to G, chromosome 5 at 145,452,880 bp (GRCm38)
  • A to T, chromosome 6 at 70,260,900 bp (GRCm38)
  • A to G, chromosome 6 at 115,741,556 bp (GRCm38)
  • A to T, chromosome 6 at 125,880,419 bp (GRCm38)
  • G to A, chromosome 6 at 134,036,099 bp (GRCm38)
  • C to T, chromosome 7 at 14,664,142 bp (GRCm38)
  • T to A, chromosome 7 at 28,441,308 bp (GRCm38)
  • T to C, chromosome 7 at 105,762,418 bp (GRCm38)
  • C to T, chromosome 7 at 132,059,922 bp (GRCm38)
  • G to A, chromosome 7 at 141,068,044 bp (GRCm38)
  • A to T, chromosome 7 at 144,411,100 bp (GRCm38)
  • C to T, chromosome 8 at 14,846,653 bp (GRCm38)
  • T to A, chromosome 8 at 40,755,202 bp (GRCm38)
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp (GRCm38)
  • A to T, chromosome 8 at 71,385,929 bp (GRCm38)
  • T to A, chromosome 8 at 106,547,764 bp (GRCm38)
  • T to A, chromosome 9 at 71,655,350 bp (GRCm38)
  • G to A, chromosome 9 at 96,688,344 bp (GRCm38)
  • T to C, chromosome 9 at 103,197,608 bp (GRCm38)
  • A to T, chromosome 9 at 110,962,642 bp (GRCm38)
  • A to G, chromosome 10 at 111,494,796 bp (GRCm38)
  • G to T, chromosome 10 at 121,553,936 bp (GRCm38)
  • A to T, chromosome 10 at 129,079,489 bp (GRCm38)
  • A to G, chromosome 11 at 23,367,385 bp (GRCm38)
  • A to T, chromosome 11 at 54,938,050 bp (GRCm38)
  • A to G, chromosome 11 at 84,819,318 bp (GRCm38)
  • T to C, chromosome 11 at 98,180,288 bp (GRCm38)
  • T to C, chromosome 11 at 99,236,239 bp (GRCm38)
  • A to G, chromosome 11 at 120,272,460 bp (GRCm38)
  • G to A, chromosome 11 at 120,620,470 bp (GRCm38)
  • C to A, chromosome 12 at 31,535,293 bp (GRCm38)
  • T to C, chromosome 12 at 76,630,715 bp (GRCm38)
  • T to G, chromosome 12 at 102,227,075 bp (GRCm38)
  • T to A, chromosome 12 at 113,545,864 bp (GRCm38)
  • A to G, chromosome 15 at 8,202,301 bp (GRCm38)
  • G to T, chromosome 15 at 27,744,072 bp (GRCm38)
  • T to C, chromosome 15 at 63,902,857 bp (GRCm38)
  • T to A, chromosome 16 at 97,578,626 bp (GRCm38)
  • T to A, chromosome 17 at 18,073,496 bp (GRCm38)
  • C to A, chromosome 17 at 19,799,263 bp (GRCm38)
  • CA to CAA, chromosome 17 at 24,527,763 bp (GRCm38)
  • A to G, chromosome 18 at 15,007,765 bp (GRCm38)
  • A to T, chromosome 18 at 42,322,121 bp (GRCm38)
  • A to G, chromosome 18 at 78,859,283 bp (GRCm38)
  • G to A, chromosome 19 at 25,410,774 bp (GRCm38)
  • T to C, chromosome 19 at 34,112,094 bp (GRCm38)
  • T to G, chromosome 19 at 46,283,398 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9680 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069473-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.