This allele from project TCPR1495 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGCTATTTGGTGGCTAATT and GTATGAGGTGTGTTTATCGG targeting a critical region. This resulted in a 2130-bp del Chr18: 37412012-37414141 (p.N47_S757del_insT) (GRCm38).

Phenotyping data may be available at mousephenotype.org.

Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.

wild-type from colony

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.

Lauryl Nutter, Ph.D., The Toronto Centre for Phenogenomics.