Strain Name:
C57BL/6J-Pex10em3Lutzy/Mmjax
Stock Number:
069586-JAX
Citation ID:
RRID:MMRRC_069586-JAX
Other Names:
Pex10^indel

Strain Information

Pex10em3Lutzy
Name: peroxisomal biogenesis factor 10; endonuclease-mediated mutation 3, Cathy Lutz
Synonyms: Pex10indel
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: CRISPR
Pex10
Name: peroxisomal biogenesis factor 10
Synonyms: peroxisome biogenesis factor 10, LOC230983
Type: Gene
Species: Mouse
Chromosome: 4
Alteration at locus: CRISPR
NCBI: 668173
HGNC: HGNC:8851
Homologene: 5671
Genetic Alterations
Pex10em3 is a CRISPR/Cas9 generated indel mutant of the peroxisomal biogenesis factor 10 gene carrying the 1nt insertion and 3 nt deletion resulting is a frameshift for 71 amino acids terminating at a TAA stop codon. These mice may be useful in studying Zellweger syndrome and peroxisome biogenesis disorders type 6A and 6B.
HVGS Nomenclature
  • Genbank RefSeq - mRNA: NM_001042407.1
  • Genbank RefSeq, protein: NP_001035866.1
  • Variant, nucleic acid level: c.857_859delinsT
  • Variant, amino acid level, predicted: p.Cys286Leufs*72
  • Check this variant: LUMC Mutalyzer
Genotype Determination
ES Cell Line
Not applicable
Phenotype

The peroxisomal biogenesis factor 10 gene (Pex10) encodes a protein involved in the import of peroxisomal matrix proteins. PEX10 is localized to the peroxisomal membrane. Mutations in this gene have been associated with Zellweger syndrome and peroxisome biogenesis disorders type 6A and 6B.

CRISPR/Cas9 endonuclease-mediated genome editing of Pex10 reated an indel mutation that starts at Cys-286 and introduces a TAA stop codon 71 amino acids later. If additional characterization of these Pex10em3 mice is performed, we may modify the strain description accordingly.

Heterozygous mice are viable and fertile. Homozygous mice are embryonic-or-perinatal lethal.

Strain Development
The Pex10em3 allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs were selected to target 5 of the peroxisomal biogenesis factor 10 gene (Pex10). Single stranded oligonucleotide donor DNAs 5-TAGGAGTTCCCTTGAAGACAGAGCCGTGTGCAGAACCCCACTCTGCACCCTATGCTTAGAGGAACGAAGACACTCCACGGCCACACCTTGCGGTGATCTCTTCTGCTGGGAGTGCATCACCGAGTGG-3 were originally designed to introduce a [H288D] point mutation (CAT->GAT) and two silent mutations in cysteine 286 and glycine 287 (TGG ->CGG and GGC->GGT, respectively) as described for MMRRC Stock No. 69585. These sequences and Cas9 nuclease were introduced into single cell C57BL/6J zygotes and transferred to pseudopregnant females. DNA sequencing of the targeted region identified genome-edited pups harboring a 1 nt insertion followed immediately by the 3 nt deletion (indel mutation). This net 2 nt deletion is predicted to cause a frameshift at Cys-286 for 71 amino acids and terminating at a TAA stop codon positioned within the 3'UTR of the wild type Pex10 gene. Those mice were then bred to C57BL/6J mice for germline transmission. The Pex10em3 colony was backcrossed to C57BL/6J for at least two generations.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish
Additional References

Steinberg SJ, Snowden A, Braverman NE, Chen L, Watkins PA, Clayton PT, Setchell KD, Heubi JE, Raymond GV, Moser AB, Moser HW. A PEX10 defect in a patient with no detectable defect in peroxisome assembly or metabolism in cultured fibroblasts. J Inherit Metab Dis. 2009 Feb;32(1):109-19. doi: 10.1007/s10545-008-0969-8. Epub 2008 Dec 25. (Medline PMID: 19127411)

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross and sib-mating
Generation
N2 (C57BL/6J), F?
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: No No
Homozygotes are fertile: No No
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Recommended wean age
4 Weeks
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069586-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
069586-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.