The Samd9lem2Lutzy (Sam9dldel43) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs (AGCCTTTGAGGCCAAACTAC, CAAACTACAGGAAATTGAAA and TATTCGTTCATGATCTTGAA) were selected to target exon 2 of the sterile alpha motif domain containing 9-like on Chromosome 6. Progeny were screened by DNA sequencing of the targeted region and were identified with a 43-bp deletion in exon 2. These mice may be useful in studying myeloid disorders.
Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.Viability and Fertility: | Female | Male | Comments |
---|---|---|---|
Homozygotes are viable: | Yes | Yes | |
Homozygotes are fertile: | Yes | Yes | |
Heterozygotes are fertile: | Yes | Yes | |
Age Reproductive Decline: | Undetermined | Undetermined |
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
MMRRC Item # | Description | Distribution Fee / Unit (US $) *Shipping & Handling not included* |
Units | Notes |
---|---|---|---|---|
069609-JAX-SPERM | Cryo-preserved spermatozoa | $459.00 / $459.00 Non-Profit / For-Profit |
Aliquot | Approximate quantity3 |
069609-JAX-RESUS | Litter recovered from cryo-archive | $2,123.00 / $2,123.00 Non-Profit / For-Profit |
Litter | Recovered litter4; additional fees for any special requests. |
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information. |
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
Text